Incidental Mutation 'R3277:Nr1h4'
ID258275
Institutional Source Beutler Lab
Gene Symbol Nr1h4
Ensembl Gene ENSMUSG00000047638
Gene Namenuclear receptor subfamily 1, group H, member 4
SynonymsRxrip14, FXR, HRR1, Fxr, RIP14
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R3277 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89454234-89533585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89478788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 282 (T282I)
Ref Sequence ENSEMBL: ENSMUSP00000053092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058126
AA Change: T282I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: T282I

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 235 285 4e-19 BLAST
HOLI 301 456 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105296
AA Change: T286I

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: T286I

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 239 289 4e-19 BLAST
HOLI 305 460 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105297
AA Change: T272I

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: T272I

DomainStartEndE-ValueType
ZnF_C4 121 192 1.93e-37 SMART
Blast:HOLI 225 275 3e-19 BLAST
HOLI 291 446 9.43e-32 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Nr1h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Nr1h4 APN 10 89478807 missense probably benign 0.42
IGL02628:Nr1h4 APN 10 89473839 missense probably damaging 1.00
Aeronaut UTSW 10 89498229 nonsense probably null
I1329:Nr1h4 UTSW 10 89483362 splice site probably benign
IGL02837:Nr1h4 UTSW 10 89516480 missense probably benign 0.00
R0590:Nr1h4 UTSW 10 89456567 missense probably damaging 0.99
R0645:Nr1h4 UTSW 10 89506528 missense probably benign 0.08
R1887:Nr1h4 UTSW 10 89454867 missense possibly damaging 0.64
R1905:Nr1h4 UTSW 10 89480559 missense possibly damaging 0.85
R2471:Nr1h4 UTSW 10 89473894 missense probably damaging 1.00
R2921:Nr1h4 UTSW 10 89498361 missense probably damaging 1.00
R3177:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R4656:Nr1h4 UTSW 10 89498253 missense probably benign 0.00
R4676:Nr1h4 UTSW 10 89473874 missense probably damaging 1.00
R4901:Nr1h4 UTSW 10 89478797 missense possibly damaging 0.68
R4993:Nr1h4 UTSW 10 89498180 missense probably benign 0.01
R5117:Nr1h4 UTSW 10 89478422 missense probably damaging 1.00
R5131:Nr1h4 UTSW 10 89483455 missense probably damaging 0.99
R5176:Nr1h4 UTSW 10 89498255 missense probably benign 0.02
R5241:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
R5580:Nr1h4 UTSW 10 89516440 missense probably benign 0.16
R6114:Nr1h4 UTSW 10 89478816 missense possibly damaging 0.61
R6814:Nr1h4 UTSW 10 89454745 missense probably damaging 0.98
R6888:Nr1h4 UTSW 10 89456542 missense probably damaging 1.00
R6990:Nr1h4 UTSW 10 89454930 missense probably benign 0.18
R7141:Nr1h4 UTSW 10 89498229 nonsense probably null
R7427:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7428:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7560:Nr1h4 UTSW 10 89498261 missense probably benign
R7986:Nr1h4 UTSW 10 89454772 missense possibly damaging 0.46
X0023:Nr1h4 UTSW 10 89454844 missense possibly damaging 0.45
Z1176:Nr1h4 UTSW 10 89498350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTGAGACTTCCTTTCCAATTG -3'
(R):5'- TCACAGCTCTTGGAGGCTTTG -3'

Sequencing Primer
(F):5'- AGACTTCCTTTCCAATTGTTTAATGC -3'
(R):5'- AATCCTTCGTCATTAGTTTGTTTCAG -3'
Posted On2015-01-23