Incidental Mutation 'R3277:Hlf'
ID 258277
Institutional Source Beutler Lab
Gene Symbol Hlf
Ensembl Gene ENSMUSG00000003949
Gene Name hepatic leukemia factor
Synonyms
Accession Numbers
Essential gene? Possibly essential (E-score: 0.671) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 90336536-90390895 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90345835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 199 (K199E)
Ref Sequence ENSEMBL: ENSMUSP00000004051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004051]
AlphaFold Q8BW74
Predicted Effect probably damaging
Transcript: ENSMUST00000004051
AA Change: K199E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004051
Gene: ENSMUSG00000003949
AA Change: K199E

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 98 111 N/A INTRINSIC
BRLZ 223 287 1.12e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137957
Predicted Effect unknown
Transcript: ENSMUST00000176001
AA Change: K111E
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Hlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0312:Hlf UTSW 11 90387875 missense possibly damaging 0.82
R1332:Hlf UTSW 11 90340853 nonsense probably null
R1863:Hlf UTSW 11 90340826 missense probably damaging 0.99
R3177:Hlf UTSW 11 90345835 missense probably damaging 1.00
R3809:Hlf UTSW 11 90388103 missense probably benign 0.38
R5129:Hlf UTSW 11 90390252 missense probably benign
R5249:Hlf UTSW 11 90387806 missense probably benign 0.01
R7751:Hlf UTSW 11 90387995 missense probably damaging 0.99
R8924:Hlf UTSW 11 90345888 missense probably damaging 1.00
X0023:Hlf UTSW 11 90345751 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TACTGTGCCAGGAAGTCACG -3'
(R):5'- GTTGACCATAAGTTAATACTCCCG -3'

Sequencing Primer
(F):5'- ATACTCGGAACTCTCAGATCTTTTG -3'
(R):5'- AAGTTAATACTCCCGTGTTTTTCCAG -3'
Posted On 2015-01-23