Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Nsf'

258279

Institutional Source

Beutler Lab

Gene Symbol

Nsf

Ensembl Gene

ENSMUSG00000034187

Gene Name

N-ethylmaleimide sensitive fusion protein

Synonyms

SKD2, N-ethylmaleimide sensitive factor

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103821782-103954056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103930752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 26 (E26K)

Ref Sequence

ENSEMBL: ENSMUSP00000099364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]

AlphaFold

P46460

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

Domain	Start	End	E-Value	Type
CDC48_N	5	86	2.7e-16	SMART
CDC48_2	111	183	6.22e-7	SMART
AAA	252	399	3.65e-19	SMART
AAA	535	671	2.2e-13	SMART
low complexity region	674	683	N/A	INTRINSIC
low complexity region	698	711	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107009

Predicted Effect

probably benign
Transcript: ENSMUST00000133774

SMART Domains

Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

Domain	Start	End	E-Value	Type
Pfam:CDC48_N	1	51	1.5e-10	PFAM
CDC48_2	76	148	6.22e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145126

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

Domain	Start	End	E-Value	Type
CDC48_N	2	76	6.51e-10	SMART

Meta Mutation Damage Score

0.0893

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Nsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Nsf	APN	11	103861885	splice site	probably benign
IGL01377:Nsf	APN	11	103872647	missense	probably damaging	0.97
IGL01994:Nsf	APN	11	103928782	missense	probably damaging	0.98
IGL02141:Nsf	APN	11	103828525	missense	probably benign	0.02
IGL02663:Nsf	APN	11	103930815	missense	probably benign	0.04
IGL02871:Nsf	APN	11	103862056	splice site	probably benign
uhaul	UTSW	11	103930752	missense	possibly damaging	0.59
R0180:Nsf	UTSW	11	103930780	missense	probably damaging	1.00
R0880:Nsf	UTSW	11	103913372	missense	possibly damaging	0.72
R1146:Nsf	UTSW	11	103828538	missense	probably damaging	1.00
R1146:Nsf	UTSW	11	103828538	missense	probably damaging	1.00
R1203:Nsf	UTSW	11	103926126	unclassified	probably benign
R1873:Nsf	UTSW	11	103859017	missense	probably damaging	1.00
R1951:Nsf	UTSW	11	103882876	nonsense	probably null
R2163:Nsf	UTSW	11	103863333	missense	possibly damaging	0.64
R2193:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2194:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2287:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2289:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2343:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2345:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2346:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2347:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2350:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2405:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2406:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2407:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2408:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2409:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2411:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2435:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2924:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2925:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2987:Nsf	UTSW	11	103859043	splice site	probably null
R3177:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3741:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3742:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3845:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R4278:Nsf	UTSW	11	103930806	missense	probably damaging	0.96
R4717:Nsf	UTSW	11	103823769	missense	probably damaging	1.00
R4775:Nsf	UTSW	11	103872593	missense	possibly damaging	0.93
R4915:Nsf	UTSW	11	103910359	unclassified	probably benign
R4918:Nsf	UTSW	11	103910359	unclassified	probably benign
R5090:Nsf	UTSW	11	103910578	missense	probably benign	0.00
R5126:Nsf	UTSW	11	103882792	nonsense	probably null
R5411:Nsf	UTSW	11	103882811	missense	probably damaging	1.00
R5560:Nsf	UTSW	11	103863255	missense	possibly damaging	0.47
R6344:Nsf	UTSW	11	103861904	missense	probably damaging	1.00
R6596:Nsf	UTSW	11	103910457	missense	probably damaging	0.98
R7155:Nsf	UTSW	11	103828530	nonsense	probably null
R7272:Nsf	UTSW	11	103827238	missense	probably damaging	1.00
R7769:Nsf	UTSW	11	103928839	missense	probably damaging	1.00
R8323:Nsf	UTSW	11	103928839	missense	probably benign	0.05
R8487:Nsf	UTSW	11	103928758	missense	probably damaging	1.00
R8856:Nsf	UTSW	11	103930742	missense	possibly damaging	0.69
R9253:Nsf	UTSW	11	103913316	missense	probably null	1.00
R9476:Nsf	UTSW	11	103873162	missense	probably damaging	1.00
R9509:Nsf	UTSW	11	103863248	missense	probably benign	0.19
R9510:Nsf	UTSW	11	103873162	missense	probably damaging	1.00
R9520:Nsf	UTSW	11	103913883	missense	probably damaging	1.00
R9546:Nsf	UTSW	11	103910449	nonsense	probably null
R9632:Nsf	UTSW	11	103823768	missense	probably damaging	1.00
R9779:Nsf	UTSW	11	103828526	missense	probably damaging	0.99
X0066:Nsf	UTSW	11	103823740	missense	probably benign
Z1176:Nsf	UTSW	11	103910554	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAAGCAAGGTGACTACCAACC -3'
(R):5'- ATGCAGTTGTGTGGTAAGGAAGG -3'

Sequencing Primer
(F):5'- TGTGATACCTATACCCAGTG -3'
(R):5'- AGGGTGCTTTCTTCTAGTGC -3'

Posted On

2015-01-23