Incidental Mutation 'R3277:Dgkb'
ID 258281
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Name diacylglycerol kinase, beta
Synonyms C630029D13Rik, DGK-beta
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 37930169-38684238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38134216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 41 (V41M)
Ref Sequence ENSEMBL: ENSMUSP00000152446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990] [ENSMUST00000221176]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040500
AA Change: V41M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: V41M

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220606
Predicted Effect possibly damaging
Transcript: ENSMUST00000220990
AA Change: V41M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221098
Predicted Effect probably damaging
Transcript: ENSMUST00000221176
AA Change: V41M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,020 (GRCm39) R553G possibly damaging Het
Adarb2 A G 13: 8,802,663 (GRCm39) N646S probably damaging Het
Adcy8 C T 15: 64,571,008 (GRCm39) G1242S probably benign Het
Ano9 T A 7: 140,684,037 (GRCm39) T543S probably damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Btnl9 T C 11: 49,060,503 (GRCm39) D330G probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Cdx2 A T 5: 147,240,002 (GRCm39) S225T probably benign Het
Clca4b T C 3: 144,617,120 (GRCm39) I843M probably benign Het
Cntn4 G A 6: 106,414,925 (GRCm39) probably null Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Duox1 T C 2: 122,170,597 (GRCm39) Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 (GRCm39) probably null Het
Fbxw2 T C 2: 34,712,762 (GRCm39) T100A probably benign Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Flg2 A T 3: 93,122,195 (GRCm39) Q1455L unknown Het
Frrs1 T C 3: 116,692,873 (GRCm39) F49S probably damaging Het
Gli3 A T 13: 15,900,567 (GRCm39) Q1318L probably benign Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7104 A T 12: 88,252,498 (GRCm39) noncoding transcript Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hacd4 T C 4: 88,355,747 (GRCm39) H46R probably damaging Het
Herc2 T C 7: 55,803,176 (GRCm39) V2175A probably benign Het
Hey1 T C 3: 8,729,951 (GRCm39) S169G probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hlf T C 11: 90,236,661 (GRCm39) K199E probably damaging Het
Hpgd C A 8: 56,751,448 (GRCm39) A92E probably damaging Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kif2a A G 13: 107,113,264 (GRCm39) I455T probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lamc3 G T 2: 31,798,637 (GRCm39) G448C probably damaging Het
Ltbp1 G A 17: 75,583,475 (GRCm39) G425D possibly damaging Het
Ltbp1 T A 17: 75,666,273 (GRCm39) probably null Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Mdh1b G A 1: 63,750,690 (GRCm39) T426M possibly damaging Het
Nr1h4 G A 10: 89,314,650 (GRCm39) T282I possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or52k2 T C 7: 102,253,783 (GRCm39) V74A possibly damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Parp9 T C 16: 35,768,578 (GRCm39) S20P probably damaging Het
Pdcd11 T C 19: 47,101,703 (GRCm39) F963L probably damaging Het
Pwp1 C T 10: 85,717,943 (GRCm39) L294F probably benign Het
Radil A G 5: 142,492,611 (GRCm39) L339P probably damaging Het
Raver1 G A 9: 20,990,573 (GRCm39) P316S possibly damaging Het
Rell1 A G 5: 64,084,330 (GRCm39) probably null Het
Rxrg A G 1: 167,463,269 (GRCm39) D257G possibly damaging Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Unc13a A C 8: 72,082,339 (GRCm39) C1642G probably benign Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Wrn A G 8: 33,807,582 (GRCm39) M292T probably damaging Het
Zfp423 A G 8: 88,508,959 (GRCm39) Y462H probably damaging Het
Zscan5b T A 7: 6,234,345 (GRCm39) Y124N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38,488,567 (GRCm39) missense probably benign 0.05
IGL00768:Dgkb APN 12 38,477,478 (GRCm39) missense probably benign 0.00
IGL00792:Dgkb APN 12 38,264,388 (GRCm39) critical splice donor site probably null
IGL00934:Dgkb APN 12 38,477,455 (GRCm39) missense probably damaging 0.98
IGL00970:Dgkb APN 12 38,240,082 (GRCm39) missense probably damaging 1.00
IGL01152:Dgkb APN 12 38,134,233 (GRCm39) missense probably damaging 1.00
IGL01489:Dgkb APN 12 38,177,384 (GRCm39) critical splice donor site probably null
IGL01993:Dgkb APN 12 38,032,009 (GRCm39) missense probably benign 0.19
IGL02212:Dgkb APN 12 38,189,413 (GRCm39) missense probably damaging 1.00
IGL02687:Dgkb APN 12 38,680,628 (GRCm39) missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38,150,399 (GRCm39) missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38,189,458 (GRCm39) missense probably damaging 1.00
IGL03174:Dgkb APN 12 38,266,053 (GRCm39) missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38,186,615 (GRCm39) missense probably damaging 0.97
R0063:Dgkb UTSW 12 38,654,112 (GRCm39) missense probably benign
R0063:Dgkb UTSW 12 38,654,112 (GRCm39) missense probably benign
R0078:Dgkb UTSW 12 38,186,540 (GRCm39) missense probably benign 0.35
R0271:Dgkb UTSW 12 38,278,025 (GRCm39) missense probably damaging 1.00
R0359:Dgkb UTSW 12 38,266,030 (GRCm39) missense probably benign 0.17
R0396:Dgkb UTSW 12 38,240,134 (GRCm39) critical splice donor site probably null
R0547:Dgkb UTSW 12 38,654,157 (GRCm39) missense probably benign 0.39
R0554:Dgkb UTSW 12 38,266,030 (GRCm39) missense probably benign 0.17
R1903:Dgkb UTSW 12 38,216,776 (GRCm39) critical splice donor site probably null
R2004:Dgkb UTSW 12 38,134,228 (GRCm39) missense probably damaging 1.00
R2265:Dgkb UTSW 12 38,240,107 (GRCm39) missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38,654,122 (GRCm39) missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38,134,216 (GRCm39) missense probably damaging 0.98
R4319:Dgkb UTSW 12 38,488,598 (GRCm39) missense probably damaging 1.00
R4446:Dgkb UTSW 12 38,234,952 (GRCm39) missense probably damaging 0.99
R4578:Dgkb UTSW 12 38,477,492 (GRCm39) missense possibly damaging 0.87
R4601:Dgkb UTSW 12 38,652,819 (GRCm39) missense probably damaging 0.96
R4799:Dgkb UTSW 12 38,164,567 (GRCm39) missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38,164,657 (GRCm39) nonsense probably null
R5380:Dgkb UTSW 12 38,177,299 (GRCm39) missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38,177,363 (GRCm39) missense probably damaging 1.00
R5556:Dgkb UTSW 12 38,177,363 (GRCm39) missense probably damaging 1.00
R6198:Dgkb UTSW 12 38,223,822 (GRCm39) missense probably benign
R6467:Dgkb UTSW 12 38,654,104 (GRCm39) missense probably damaging 1.00
R6467:Dgkb UTSW 12 38,134,223 (GRCm39) missense possibly damaging 0.65
R6792:Dgkb UTSW 12 38,150,424 (GRCm39) missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38,150,492 (GRCm39) missense probably benign
R7116:Dgkb UTSW 12 38,031,989 (GRCm39) missense probably benign 0.00
R7251:Dgkb UTSW 12 38,031,985 (GRCm39) missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38,234,931 (GRCm39) missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38,197,554 (GRCm39) nonsense probably null
R7342:Dgkb UTSW 12 38,150,432 (GRCm39) missense probably benign 0.00
R7535:Dgkb UTSW 12 38,186,646 (GRCm39) missense probably damaging 1.00
R7540:Dgkb UTSW 12 38,031,789 (GRCm39) start gained probably benign
R7584:Dgkb UTSW 12 38,189,391 (GRCm39) splice site probably null
R7714:Dgkb UTSW 12 38,680,592 (GRCm39) missense probably damaging 0.99
R7885:Dgkb UTSW 12 38,189,425 (GRCm39) missense probably damaging 1.00
R8012:Dgkb UTSW 12 38,189,485 (GRCm39) missense probably benign 0.31
R8050:Dgkb UTSW 12 38,174,216 (GRCm39) missense probably benign 0.38
R8089:Dgkb UTSW 12 38,234,949 (GRCm39) missense probably damaging 1.00
R8103:Dgkb UTSW 12 38,186,580 (GRCm39) missense probably damaging 1.00
R8400:Dgkb UTSW 12 38,652,837 (GRCm39) critical splice donor site probably null
R8418:Dgkb UTSW 12 38,380,016 (GRCm39) missense probably damaging 1.00
R8473:Dgkb UTSW 12 38,234,939 (GRCm39) missense probably damaging 0.99
R8739:Dgkb UTSW 12 38,278,323 (GRCm39) intron probably benign
R8744:Dgkb UTSW 12 38,488,611 (GRCm39) missense probably damaging 0.98
R8943:Dgkb UTSW 12 38,652,777 (GRCm39) missense probably damaging 0.97
R8962:Dgkb UTSW 12 38,189,494 (GRCm39) critical splice donor site probably null
R9182:Dgkb UTSW 12 38,216,776 (GRCm39) critical splice donor site probably null
R9398:Dgkb UTSW 12 38,189,657 (GRCm39) missense probably damaging 1.00
X0023:Dgkb UTSW 12 38,277,988 (GRCm39) missense probably benign 0.00
X0027:Dgkb UTSW 12 38,278,124 (GRCm39) critical splice donor site probably null
Z1176:Dgkb UTSW 12 38,186,612 (GRCm39) missense probably damaging 0.99
Z1176:Dgkb UTSW 12 38,031,995 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GAGAGACTGTGACCTGAATCC -3'
(R):5'- AATATACTGTATTTAGTGGCCTTCCAC -3'

Sequencing Primer
(F):5'- GAACTTGGGTTTACTCATCAGC -3'
(R):5'- TGCTAAATGGTTTATGGTATGTGAG -3'
Posted On 2015-01-23