Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Hsp90aa1'

258285

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 110695680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1 (M1L)

Ref Sequence

ENSEMBL: ENSMUSP00000121138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

unknown
Transcript: ENSMUST00000021698
AA Change: M1L

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000094361
AA Change: M1L

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124156
AA Change: M1L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189
AA Change: M1L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270
AA Change: M1L

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.5676

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCAGGGAAAGCAACGTCC -3'
(R):5'- CATGCGCTTCGTAATTACCG -3'

Sequencing Primer
(F):5'- ATCCTCCAAGTGGTATACTCACG -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'

Posted On

2015-01-23