Incidental Mutation 'R3277:Gli3'
ID 258287
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15900567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1318 (Q1318L)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: Q1318L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: Q1318L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,020 (GRCm39) R553G possibly damaging Het
Adarb2 A G 13: 8,802,663 (GRCm39) N646S probably damaging Het
Adcy8 C T 15: 64,571,008 (GRCm39) G1242S probably benign Het
Ano9 T A 7: 140,684,037 (GRCm39) T543S probably damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Btnl9 T C 11: 49,060,503 (GRCm39) D330G probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Cdx2 A T 5: 147,240,002 (GRCm39) S225T probably benign Het
Clca4b T C 3: 144,617,120 (GRCm39) I843M probably benign Het
Cntn4 G A 6: 106,414,925 (GRCm39) probably null Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dgkb G A 12: 38,134,216 (GRCm39) V41M probably damaging Het
Duox1 T C 2: 122,170,597 (GRCm39) Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 (GRCm39) probably null Het
Fbxw2 T C 2: 34,712,762 (GRCm39) T100A probably benign Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Flg2 A T 3: 93,122,195 (GRCm39) Q1455L unknown Het
Frrs1 T C 3: 116,692,873 (GRCm39) F49S probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7104 A T 12: 88,252,498 (GRCm39) noncoding transcript Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hacd4 T C 4: 88,355,747 (GRCm39) H46R probably damaging Het
Herc2 T C 7: 55,803,176 (GRCm39) V2175A probably benign Het
Hey1 T C 3: 8,729,951 (GRCm39) S169G probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hlf T C 11: 90,236,661 (GRCm39) K199E probably damaging Het
Hpgd C A 8: 56,751,448 (GRCm39) A92E probably damaging Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kif2a A G 13: 107,113,264 (GRCm39) I455T probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lamc3 G T 2: 31,798,637 (GRCm39) G448C probably damaging Het
Ltbp1 G A 17: 75,583,475 (GRCm39) G425D possibly damaging Het
Ltbp1 T A 17: 75,666,273 (GRCm39) probably null Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Mdh1b G A 1: 63,750,690 (GRCm39) T426M possibly damaging Het
Nr1h4 G A 10: 89,314,650 (GRCm39) T282I possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or52k2 T C 7: 102,253,783 (GRCm39) V74A possibly damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Parp9 T C 16: 35,768,578 (GRCm39) S20P probably damaging Het
Pdcd11 T C 19: 47,101,703 (GRCm39) F963L probably damaging Het
Pwp1 C T 10: 85,717,943 (GRCm39) L294F probably benign Het
Radil A G 5: 142,492,611 (GRCm39) L339P probably damaging Het
Raver1 G A 9: 20,990,573 (GRCm39) P316S possibly damaging Het
Rell1 A G 5: 64,084,330 (GRCm39) probably null Het
Rxrg A G 1: 167,463,269 (GRCm39) D257G possibly damaging Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Unc13a A C 8: 72,082,339 (GRCm39) C1642G probably benign Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Wrn A G 8: 33,807,582 (GRCm39) M292T probably damaging Het
Zfp423 A G 8: 88,508,959 (GRCm39) Y462H probably damaging Het
Zscan5b T A 7: 6,234,345 (GRCm39) Y124N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTTAAGACCCAGCAGTATGG -3'
(R):5'- TGATAGCTGCCATGCTTGATG -3'

Sequencing Primer
(F):5'- CAGTATGGGAGCCAGCTCAAC -3'
(R):5'- CCATGCTTGATGGCTGGC -3'
Posted On 2015-01-23