Incidental Mutation 'R3277:Kif2a'
ID 258288
Institutional Source Beutler Lab
Gene Symbol Kif2a
Ensembl Gene ENSMUSG00000021693
Gene Name kinesin family member 2A
Synonyms Kns2, Kif2, M-kinesin
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 106958996-107022126 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106976756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 455 (I455T)
Ref Sequence ENSEMBL: ENSMUSP00000125644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022204] [ENSMUST00000117423] [ENSMUST00000117539] [ENSMUST00000122233] [ENSMUST00000159772]
AlphaFold P28740
Predicted Effect probably damaging
Transcript: ENSMUST00000022204
AA Change: I455T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022204
Gene: ENSMUSG00000021693
AA Change: I455T

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 6.56e-147 SMART
low complexity region 613 625 N/A INTRINSIC
coiled coil region 660 698 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117423
AA Change: I409T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113921
Gene: ENSMUSG00000021693
AA Change: I409T

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 113 137 N/A INTRINSIC
KISc 174 514 6.56e-147 SMART
low complexity region 567 579 N/A INTRINSIC
coiled coil region 614 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117539
AA Change: I439T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113361
Gene: ENSMUSG00000021693
AA Change: I439T

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
KISc 204 544 6.56e-147 SMART
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122233
AA Change: I428T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112715
Gene: ENSMUSG00000021693
AA Change: I428T

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
KISc 193 533 4.33e-147 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
coiled coil region 671 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159772
AA Change: I455T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125644
Gene: ENSMUSG00000021693
AA Change: I455T

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 4.33e-147 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
coiled coil region 698 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality, abnormal lamination of the cerebral cortex, hippocampus and cerebellum, impaired neuronal migration, and abnormal axon outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Kif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Kif2a APN 13 106968793 splice site probably benign
IGL01640:Kif2a APN 13 106974552 missense probably damaging 1.00
IGL02524:Kif2a APN 13 106964355 missense possibly damaging 0.82
R0088:Kif2a UTSW 13 106975432 missense probably damaging 1.00
R0276:Kif2a UTSW 13 106976650 splice site probably benign
R1233:Kif2a UTSW 13 106987332 missense probably damaging 1.00
R1345:Kif2a UTSW 13 106993915 missense probably damaging 0.99
R1772:Kif2a UTSW 13 106978132 intron probably benign
R1900:Kif2a UTSW 13 106976995 missense possibly damaging 0.46
R1932:Kif2a UTSW 13 106978091 missense probably benign 0.00
R2364:Kif2a UTSW 13 106976836 missense probably damaging 1.00
R3177:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R4646:Kif2a UTSW 13 106962185 missense probably damaging 1.00
R5566:Kif2a UTSW 13 106993924 splice site probably null 1.00
R5761:Kif2a UTSW 13 106962164 missense probably benign 0.05
R5797:Kif2a UTSW 13 106975376 missense probably damaging 1.00
R6812:Kif2a UTSW 13 106969751 missense probably benign 0.00
R7025:Kif2a UTSW 13 106982594 missense probably damaging 1.00
R7792:Kif2a UTSW 13 106987982 missense probably benign 0.06
R8679:Kif2a UTSW 13 106979541 missense probably damaging 0.98
R8972:Kif2a UTSW 13 106979035 missense probably damaging 1.00
R9569:Kif2a UTSW 13 106968738 missense probably benign 0.00
R9627:Kif2a UTSW 13 107022050 missense possibly damaging 0.56
R9733:Kif2a UTSW 13 106969796 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGAGCAACCGCAGAAATG -3'
(R):5'- TTATCGTACCAGCAAAGCCAG -3'

Sequencing Primer
(F):5'- ACCGCAGAAATGGCCTG -3'
(R):5'- TATCGTACCAGCAAAGCCAGAAGAC -3'
Posted On 2015-01-23