Incidental Mutation 'R3277:Ttc23l'
ID 258289
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Name tetratricopeptide repeat domain 23-like
Synonyms 4930401A09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 10500188-10558754 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10547318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 99 (F99L)
Ref Sequence ENSEMBL: ENSMUSP00000022857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
AlphaFold A6H6E9
Predicted Effect possibly damaging
Transcript: ENSMUST00000022857
AA Change: F99L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: F99L

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: F99L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: F99L

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: F99L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.3963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,020 (GRCm39) R553G possibly damaging Het
Adarb2 A G 13: 8,802,663 (GRCm39) N646S probably damaging Het
Adcy8 C T 15: 64,571,008 (GRCm39) G1242S probably benign Het
Ano9 T A 7: 140,684,037 (GRCm39) T543S probably damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Btnl9 T C 11: 49,060,503 (GRCm39) D330G probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Cdx2 A T 5: 147,240,002 (GRCm39) S225T probably benign Het
Clca4b T C 3: 144,617,120 (GRCm39) I843M probably benign Het
Cntn4 G A 6: 106,414,925 (GRCm39) probably null Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dgkb G A 12: 38,134,216 (GRCm39) V41M probably damaging Het
Duox1 T C 2: 122,170,597 (GRCm39) Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 (GRCm39) probably null Het
Fbxw2 T C 2: 34,712,762 (GRCm39) T100A probably benign Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Flg2 A T 3: 93,122,195 (GRCm39) Q1455L unknown Het
Frrs1 T C 3: 116,692,873 (GRCm39) F49S probably damaging Het
Gli3 A T 13: 15,900,567 (GRCm39) Q1318L probably benign Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7104 A T 12: 88,252,498 (GRCm39) noncoding transcript Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hacd4 T C 4: 88,355,747 (GRCm39) H46R probably damaging Het
Herc2 T C 7: 55,803,176 (GRCm39) V2175A probably benign Het
Hey1 T C 3: 8,729,951 (GRCm39) S169G probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hlf T C 11: 90,236,661 (GRCm39) K199E probably damaging Het
Hpgd C A 8: 56,751,448 (GRCm39) A92E probably damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kif2a A G 13: 107,113,264 (GRCm39) I455T probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lamc3 G T 2: 31,798,637 (GRCm39) G448C probably damaging Het
Ltbp1 G A 17: 75,583,475 (GRCm39) G425D possibly damaging Het
Ltbp1 T A 17: 75,666,273 (GRCm39) probably null Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Mdh1b G A 1: 63,750,690 (GRCm39) T426M possibly damaging Het
Nr1h4 G A 10: 89,314,650 (GRCm39) T282I possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or52k2 T C 7: 102,253,783 (GRCm39) V74A possibly damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Parp9 T C 16: 35,768,578 (GRCm39) S20P probably damaging Het
Pdcd11 T C 19: 47,101,703 (GRCm39) F963L probably damaging Het
Pwp1 C T 10: 85,717,943 (GRCm39) L294F probably benign Het
Radil A G 5: 142,492,611 (GRCm39) L339P probably damaging Het
Raver1 G A 9: 20,990,573 (GRCm39) P316S possibly damaging Het
Rell1 A G 5: 64,084,330 (GRCm39) probably null Het
Rxrg A G 1: 167,463,269 (GRCm39) D257G possibly damaging Het
Sema4c C T 1: 36,588,960 (GRCm39) R722H possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Unc13a A C 8: 72,082,339 (GRCm39) C1642G probably benign Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Wrn A G 8: 33,807,582 (GRCm39) M292T probably damaging Het
Zfp423 A G 8: 88,508,959 (GRCm39) Y462H probably damaging Het
Zscan5b T A 7: 6,234,345 (GRCm39) Y124N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10,530,775 (GRCm39) missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10,509,492 (GRCm39) splice site probably benign
IGL01562:Ttc23l APN 15 10,551,476 (GRCm39) splice site probably benign
IGL01969:Ttc23l APN 15 10,551,520 (GRCm39) nonsense probably null
IGL03172:Ttc23l APN 15 10,537,652 (GRCm39) missense probably benign 0.06
R0042:Ttc23l UTSW 15 10,551,627 (GRCm39) missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10,551,627 (GRCm39) missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10,540,049 (GRCm39) missense probably benign 0.26
R0554:Ttc23l UTSW 15 10,530,743 (GRCm39) missense probably benign 0.12
R0609:Ttc23l UTSW 15 10,504,622 (GRCm39) missense probably benign
R0631:Ttc23l UTSW 15 10,540,066 (GRCm39) missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10,523,744 (GRCm39) missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10,547,342 (GRCm39) missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2276:Ttc23l UTSW 15 10,523,678 (GRCm39) missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10,523,678 (GRCm39) missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10,523,678 (GRCm39) missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10,523,678 (GRCm39) missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2368:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2420:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2420:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2421:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2422:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2422:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2830:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2831:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2831:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2979:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2980:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2980:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2981:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2981:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2982:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R2982:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2983:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R2983:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R3176:Ttc23l UTSW 15 10,547,318 (GRCm39) missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10,547,318 (GRCm39) missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10,547,318 (GRCm39) missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R3722:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R3743:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R3743:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R3767:Ttc23l UTSW 15 10,530,781 (GRCm39) missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R3921:Ttc23l UTSW 15 10,537,649 (GRCm39) small insertion probably benign
R3921:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R4091:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R4091:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R4119:Ttc23l UTSW 15 10,540,006 (GRCm39) missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10,540,006 (GRCm39) missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R4373:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R4375:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R4375:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R4376:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R4376:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R4377:Ttc23l UTSW 15 10,537,648 (GRCm39) small insertion probably benign
R4377:Ttc23l UTSW 15 10,537,652 (GRCm39) missense probably benign 0.06
R5002:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10,515,236 (GRCm39) missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10,533,745 (GRCm39) missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10,551,555 (GRCm39) missense probably benign 0.01
R5793:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10,551,636 (GRCm39) missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10,537,682 (GRCm39) missense probably benign 0.07
R6976:Ttc23l UTSW 15 10,537,666 (GRCm39) nonsense probably null
R7010:Ttc23l UTSW 15 10,515,224 (GRCm39) missense probably damaging 1.00
R7342:Ttc23l UTSW 15 10,551,583 (GRCm39) missense probably benign 0.01
R7404:Ttc23l UTSW 15 10,551,663 (GRCm39) missense probably damaging 0.98
R7453:Ttc23l UTSW 15 10,533,853 (GRCm39) missense probably damaging 1.00
R7584:Ttc23l UTSW 15 10,533,794 (GRCm39) missense probably damaging 1.00
R7599:Ttc23l UTSW 15 10,533,766 (GRCm39) missense possibly damaging 0.89
R8710:Ttc23l UTSW 15 10,540,021 (GRCm39) missense probably damaging 1.00
R8927:Ttc23l UTSW 15 10,530,720 (GRCm39) missense probably damaging 1.00
R8928:Ttc23l UTSW 15 10,530,720 (GRCm39) missense probably damaging 1.00
R9101:Ttc23l UTSW 15 10,537,661 (GRCm39) missense probably benign 0.16
R9746:Ttc23l UTSW 15 10,523,729 (GRCm39) missense probably benign 0.01
R9782:Ttc23l UTSW 15 10,530,767 (GRCm39) missense probably damaging 1.00
R9792:Ttc23l UTSW 15 10,537,731 (GRCm39) missense probably benign
R9793:Ttc23l UTSW 15 10,537,731 (GRCm39) missense probably benign
R9795:Ttc23l UTSW 15 10,537,731 (GRCm39) missense probably benign
Z1088:Ttc23l UTSW 15 10,533,753 (GRCm39) missense probably damaging 1.00
Z1177:Ttc23l UTSW 15 10,533,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCTCCTTTGTCCATGGAG -3'
(R):5'- CCAAGCAGACTCAGTGTGATG -3'

Sequencing Primer
(F):5'- CACATTCTCTTTATGCAGTGTGG -3'
(R):5'- TCAGTGTGATGAGAGGGGGC -3'
Posted On 2015-01-23