Incidental Mutation 'R3407:Sh3bp4'
ID 258294
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 040625-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3407 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 89070415-89155068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89145047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 539 (C539F)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect possibly damaging
Transcript: ENSMUST00000066279
AA Change: C539F

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: C539F

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89145592 missense possibly damaging 0.62
R3408:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R5908:Sh3bp4 UTSW 1 89145883 missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89153166 missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 splice site probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89145315 missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89145575 missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89152342 missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89144437 missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89144925 nonsense probably null
R9718:Sh3bp4 UTSW 1 89145750 missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Z1176:Sh3bp4 UTSW 1 89145728 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGGTCTCTATGGTCCCAAACAC -3'
(R):5'- GCGGAGTCTGGACACAAAAC -3'

Sequencing Primer
(F):5'- CATCCATCCATCCTTCAAGACAGTAG -3'
(R):5'- TCTGGACACAAAACTGCGTG -3'
Posted On 2015-01-23