Incidental Mutation 'R3407:Olfr1413'
ID258295
Institutional Source Beutler Lab
Gene Symbol Olfr1413
Ensembl Gene ENSMUSG00000058904
Gene Nameolfactory receptor 1413
SynonymsGA_x6K02T2R7CC-81180849-81179878, MOR208-1
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92571322-92574397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92573953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 261 (T261A)
Ref Sequence ENSEMBL: ENSMUSP00000150792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074859] [ENSMUST00000214239]
Predicted Effect probably damaging
Transcript: ENSMUST00000074859
AA Change: T261A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074402
Gene: ENSMUSG00000058904
AA Change: T261A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 2.3e-50 PFAM
Pfam:7tm_1 48 297 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185802
Predicted Effect probably damaging
Transcript: ENSMUST00000214239
AA Change: T261A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Olfr1413
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Olfr1413 APN 1 92573443 missense probably benign 0.01
IGL01829:Olfr1413 APN 1 92573329 missense probably benign 0.37
IGL02160:Olfr1413 APN 1 92573357 missense probably damaging 1.00
IGL02535:Olfr1413 APN 1 92573221 missense probably benign 0.10
IGL03304:Olfr1413 APN 1 92573303 missense probably benign 0.01
R0001:Olfr1413 UTSW 1 92573461 missense possibly damaging 0.62
R0033:Olfr1413 UTSW 1 92573260 missense probably benign 0.05
R2027:Olfr1413 UTSW 1 92573767 missense probably damaging 0.99
R2152:Olfr1413 UTSW 1 92573908 missense probably damaging 1.00
R2174:Olfr1413 UTSW 1 92573657 missense probably benign 0.00
R3408:Olfr1413 UTSW 1 92573953 missense probably damaging 0.99
R3951:Olfr1413 UTSW 1 92573789 missense possibly damaging 0.53
R4687:Olfr1413 UTSW 1 92573330 missense possibly damaging 0.63
R4793:Olfr1413 UTSW 1 92573485 missense possibly damaging 0.89
R5069:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5070:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5160:Olfr1413 UTSW 1 92573822 missense probably benign 0.02
R5411:Olfr1413 UTSW 1 92573824 missense probably benign 0.00
R7487:Olfr1413 UTSW 1 92573795 missense possibly damaging 0.49
R7677:Olfr1413 UTSW 1 92573261 missense not run
R7832:Olfr1413 UTSW 1 92573497 missense probably benign 0.03
R7860:Olfr1413 UTSW 1 92574088 missense probably benign 0.11
R7915:Olfr1413 UTSW 1 92573497 missense probably benign 0.03
R7943:Olfr1413 UTSW 1 92574088 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTTCTACTGTGATGTGCCC -3'
(R):5'- AGGCTATGTCTCTGTCCCAG -3'

Sequencing Primer
(F):5'- GTGCTGACACAACTCTCAATGAG -3'
(R):5'- TGTCCCAGCCTCCTCGG -3'
Posted On2015-01-23