Incidental Mutation 'R3407:Cybrd1'
ID258297
Institutional Source Beutler Lab
Gene Symbol Cybrd1
Ensembl Gene ENSMUSG00000027015
Gene Namecytochrome b reductase 1
Synonyms2210407P13Rik, Dcytb
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71117923-71142926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71118126 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 3 (M3L)
Ref Sequence ENSEMBL: ENSMUSP00000028403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028403]
Predicted Effect probably damaging
Transcript: ENSMUST00000028403
AA Change: M3L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028403
Gene: ENSMUSG00000027015
AA Change: M3L

DomainStartEndE-ValueType
B561 49 178 5.7e-47 SMART
low complexity region 259 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in liver weight and liver iron content when fed an iron-deficient diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Cybrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Cybrd1 APN 2 71129706 missense probably damaging 1.00
IGL02602:Cybrd1 APN 2 71118148 missense probably damaging 1.00
FR4976:Cybrd1 UTSW 2 71138511 small deletion probably benign
R0379:Cybrd1 UTSW 2 71129755 missense probably benign 0.23
R1868:Cybrd1 UTSW 2 71137634 missense possibly damaging 0.81
R1872:Cybrd1 UTSW 2 71129760 missense probably benign 0.03
R5388:Cybrd1 UTSW 2 71137645 critical splice donor site probably null
R6164:Cybrd1 UTSW 2 71118274 missense probably damaging 1.00
R6192:Cybrd1 UTSW 2 71137514 missense probably null 1.00
R7023:Cybrd1 UTSW 2 71138578 missense probably benign 0.01
R7237:Cybrd1 UTSW 2 71118209 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTCAAGGAGGTTGGATGC -3'
(R):5'- ATGAAGACGAAGCCGGTCAC -3'

Sequencing Primer
(F):5'- CTCAAGGAGGTTGGATGCTTCTTC -3'
(R):5'- AAGCCGGTCACCGCGAG -3'
Posted On2015-01-23