Incidental Mutation 'R3407:Agbl2'
ID258300
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene NameATP/GTP binding protein-like 2
SynonymsA430081C19Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3407 (G1)
Quality Score164
Status Not validated
Chromosome2
Chromosomal Location90782727-90834437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90791618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 150 (V150I)
Ref Sequence ENSEMBL: ENSMUSP00000115632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably damaging
Transcript: ENSMUST00000037206
AA Change: V150I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037219
AA Change: V150I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051831
AA Change: V150I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111481
AA Change: V150I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136058
AA Change: V150I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149361
Predicted Effect probably damaging
Transcript: ENSMUST00000170320
AA Change: V150I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: V150I

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90801045 missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90793960 missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90801074 missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90784024 utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90801342 missense probably benign 0.23
IGL02715:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90805815 missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90801222 missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90797563 missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90791481 missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90784098 missense probably damaging 1.00
R0441:Agbl2 UTSW 2 90797483 nonsense probably null
R0549:Agbl2 UTSW 2 90789843 splice site probably benign
R0665:Agbl2 UTSW 2 90801210 missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90788954 missense probably benign
R1682:Agbl2 UTSW 2 90784090 missense probably benign 0.06
R1694:Agbl2 UTSW 2 90801320 missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90810745 missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90816376 utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90815441 missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90811282 missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90805901 missense possibly damaging 0.85
R3710:Agbl2 UTSW 2 90805808 missense probably benign 0.00
R4227:Agbl2 UTSW 2 90801453 missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90815389 missense probably benign 0.01
R4903:Agbl2 UTSW 2 90797473 missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90803197 missense probably benign 0.10
R5535:Agbl2 UTSW 2 90810006 missense probably benign 0.26
R5677:Agbl2 UTSW 2 90807978 missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90808027 missense probably benign 0.00
R6195:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6233:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6607:Agbl2 UTSW 2 90801326 missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90803074 missense probably damaging 1.00
R7104:Agbl2 UTSW 2 90797547 missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90788944 missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90791555 missense probably damaging 1.00
R7704:Agbl2 UTSW 2 90789005 missense probably benign 0.05
R7833:Agbl2 UTSW 2 90815433 missense probably benign 0.00
R7960:Agbl2 UTSW 2 90791631 missense probably benign 0.01
R8070:Agbl2 UTSW 2 90791565 missense probably benign 0.00
R8248:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8249:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8250:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8501:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGCTCATGTATCCGC -3'
(R):5'- GACTTAAACCCTGCAGCCTTG -3'

Sequencing Primer
(F):5'- GCTCTTTCTCCCTGCAGAC -3'
(R):5'- CCCTGCAGCCTTGTAATAAAGTAAG -3'
Posted On2015-01-23