Incidental Mutation 'R3407:Ambra1'
ID258301
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Nameautophagy/beclin 1 regulator 1
Synonyms2310079H06Rik, D030051N19Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91730134-91918849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91910307 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 924 (S924P)
Ref Sequence ENSEMBL: ENSMUSP00000106949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
Predicted Effect probably damaging
Transcript: ENSMUST00000045699
AA Change: S924P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: S924P

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045705
AA Change: S1044P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: S1044P

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099712
AA Change: S953P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: S953P

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111316
AA Change: S984P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: S984P

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111317
AA Change: S924P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: S924P

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91911589 missense probably benign 0.01
IGL00861:Ambra1 APN 2 91770926 missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91767682 splice site probably benign
IGL01371:Ambra1 APN 2 91825286 missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91885632 missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91911412 critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91767719 missense probably benign 0.01
IGL02170:Ambra1 APN 2 91767087 missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91917668 missense probably benign
IGL02212:Ambra1 APN 2 91917361 missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91769054 missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91886920 missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91900532 missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91911448 missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91911428 missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91767711 missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91810219 splice site probably benign
R0414:Ambra1 UTSW 2 91875739 missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91824465 missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91769036 missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91770896 splice site probably benign
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1533:Ambra1 UTSW 2 91886865 missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91911461 missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91885719 missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91766600 missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91875787 missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91917461 missense probably damaging 1.00
R3732:Ambra1 UTSW 2 91810131 missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91900558 missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91772846 missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91772694 intron probably benign
R5007:Ambra1 UTSW 2 91772310 missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91885606 missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91875754 missense probably damaging 1.00
R6364:Ambra1 UTSW 2 91773316 missense possibly damaging 0.66
R6413:Ambra1 UTSW 2 91769084 missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91917533 missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91769027 missense probably damaging 1.00
R6964:Ambra1 UTSW 2 91917416 nonsense probably null
R6970:Ambra1 UTSW 2 91772600 intron probably benign
R6982:Ambra1 UTSW 2 91917473 missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91767758 missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91917684 missense probably benign 0.26
R7786:Ambra1 UTSW 2 91767796 missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91766566 start codon destroyed probably benign 0.00
R7825:Ambra1 UTSW 2 91767761 missense probably damaging 1.00
R7860:Ambra1 UTSW 2 91773493 missense probably benign 0.27
R7943:Ambra1 UTSW 2 91773493 missense probably benign 0.27
Z1177:Ambra1 UTSW 2 91768999 missense possibly damaging 0.81
Z1177:Ambra1 UTSW 2 91875786 missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91900608 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTCCAAGAAGAAGCCTATTGAAG -3'
(R):5'- ACTGTACGTAAAAGCCTAAGACAG -3'

Sequencing Primer
(F):5'- CCTATTGAAGGCATTTGGGATATTC -3'
(R):5'- CCTAAGACAGGTAACAGATCAAGG -3'
Posted On2015-01-23