Incidental Mutation 'R3407:Zbtb10'
ID258303
Institutional Source Beutler Lab
Gene Symbol Zbtb10
Ensembl Gene ENSMUSG00000069114
Gene Namezinc finger and BTB domain containing 10
Synonyms
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location9250602-9285333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9264866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 428 (N428S)
Ref Sequence ENSEMBL: ENSMUSP00000119386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155203]
Predicted Effect probably damaging
Transcript: ENSMUST00000155203
AA Change: N428S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: N428S

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 75 82 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 180 222 N/A INTRINSIC
ZnF_TTF 239 321 7.92e-2 SMART
BTB 357 456 4.02e-20 SMART
internal_repeat_1 648 671 2.82e-12 PROSPERO
internal_repeat_1 672 695 2.82e-12 PROSPERO
ZnF_C2H2 714 736 6.78e-3 SMART
ZnF_C2H2 742 764 2.09e-3 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Zbtb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Zbtb10 APN 3 9251812 missense probably damaging 0.96
IGL02207:Zbtb10 APN 3 9280465 critical splice donor site probably null
IGL02499:Zbtb10 APN 3 9251740 missense probably damaging 1.00
IGL02506:Zbtb10 APN 3 9265237 missense probably damaging 0.99
IGL03294:Zbtb10 APN 3 9280987 missense probably benign 0.18
R0510:Zbtb10 UTSW 3 9264668 missense probably damaging 1.00
R1859:Zbtb10 UTSW 3 9280386 missense possibly damaging 0.47
R2342:Zbtb10 UTSW 3 9265195 missense possibly damaging 0.60
R4161:Zbtb10 UTSW 3 9280296 missense probably damaging 1.00
R4301:Zbtb10 UTSW 3 9265160 missense probably damaging 0.96
R4698:Zbtb10 UTSW 3 9264550 missense possibly damaging 0.87
R5184:Zbtb10 UTSW 3 9264671 missense probably damaging 0.99
R5443:Zbtb10 UTSW 3 9280048 missense probably benign
R5665:Zbtb10 UTSW 3 9265192 missense probably damaging 0.99
R5744:Zbtb10 UTSW 3 9264563 missense probably damaging 1.00
R5862:Zbtb10 UTSW 3 9265216 missense probably damaging 0.98
R5909:Zbtb10 UTSW 3 9280049 missense probably benign 0.14
R6547:Zbtb10 UTSW 3 9251703 missense probably benign 0.38
R6612:Zbtb10 UTSW 3 9252065 missense possibly damaging 0.87
R7457:Zbtb10 UTSW 3 9251478 missense possibly damaging 0.77
Z1177:Zbtb10 UTSW 3 9278331 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGGTGAGCGGGAAAATC -3'
(R):5'- AGCTGGCGATCTTCTGTTCC -3'

Sequencing Primer
(F):5'- TGAGCGGGAAAATCTTTAAAGCTC -3'
(R):5'- GCGATCTTCTGTTCCCGTGAG -3'
Posted On2015-01-23