Incidental Mutation 'R3407:Mfsd1'
ID258305
Institutional Source Beutler Lab
Gene Symbol Mfsd1
Ensembl Gene ENSMUSG00000027775
Gene Namemajor facilitator superfamily domain containing 1
Synonyms1200003O06Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location67582741-67604237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67596713 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 346 (M346K)
Ref Sequence ENSEMBL: ENSMUSP00000029344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029344
AA Change: M346K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029344
Gene: ENSMUSG00000027775
AA Change: M346K

DomainStartEndE-ValueType
Pfam:MFS_1 45 404 2.3e-31 PFAM
Pfam:MFS_2 175 443 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192776
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Mfsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Mfsd1 APN 3 67587911 splice site probably benign
IGL02186:Mfsd1 APN 3 67596595 missense probably benign 0.00
IGL02209:Mfsd1 APN 3 67598132 splice site probably benign
IGL02293:Mfsd1 APN 3 67598092 missense probably damaging 1.00
IGL03132:Mfsd1 APN 3 67587940 missense possibly damaging 0.53
edelweiss UTSW 3 67596603 nonsense probably null
Schneeweiss UTSW 3 67585662 missense possibly damaging 0.79
white UTSW 3 67589829 critical splice acceptor site probably null
R0948:Mfsd1 UTSW 3 67596734 missense possibly damaging 0.61
R2355:Mfsd1 UTSW 3 67601335 missense probably damaging 1.00
R3408:Mfsd1 UTSW 3 67596713 missense possibly damaging 0.70
R3729:Mfsd1 UTSW 3 67582965 missense probably benign 0.03
R3749:Mfsd1 UTSW 3 67582953 missense probably benign 0.09
R4405:Mfsd1 UTSW 3 67600610 missense probably benign 0.07
R4867:Mfsd1 UTSW 3 67587987 critical splice donor site probably null
R5429:Mfsd1 UTSW 3 67599960 missense probably damaging 1.00
R5456:Mfsd1 UTSW 3 67589833 missense probably benign 0.28
R5892:Mfsd1 UTSW 3 67589829 critical splice acceptor site probably null
R6091:Mfsd1 UTSW 3 67599937 splice site probably null
R6120:Mfsd1 UTSW 3 67594385 nonsense probably null
R6671:Mfsd1 UTSW 3 67585662 missense possibly damaging 0.79
R6752:Mfsd1 UTSW 3 67596603 nonsense probably null
R6799:Mfsd1 UTSW 3 67599981 missense probably damaging 0.97
R7117:Mfsd1 UTSW 3 67600058 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTAGAGGAGCGAGGCTTTGC -3'
(R):5'- GATTCCCTACTAAATAAGCCAACTG -3'

Sequencing Primer
(F):5'- AGCGAGGCTTTGCTTTGG -3'
(R):5'- AGCCAACTGAAAAACAAACTTTATAG -3'
Posted On2015-01-23