Incidental Mutation 'R3407:Fnbp1l'
ID258308
Institutional Source Beutler Lab
Gene Symbol Fnbp1l
Ensembl Gene ENSMUSG00000039735
Gene Nameformin binding protein 1-like
SynonymsTOCA1, 2610318I01Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122538719-122619715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122552150 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 229 (W229G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162409] [ENSMUST00000162947]
Predicted Effect probably benign
Transcript: ENSMUST00000162409
SMART Domains Protein: ENSMUSP00000124439
Gene: ENSMUSG00000039735

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
PDB:2KE4|A 331 426 3e-30 PDB
low complexity region 468 477 N/A INTRINSIC
SH3 483 540 5.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162947
AA Change: W384G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124947
Gene: ENSMUSG00000039735
AA Change: W384G

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PDB:2KE4|A 389 484 4e-30 PDB
low complexity region 526 535 N/A INTRINSIC
SH3 541 598 5.27e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197259
AA Change: W229G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197342
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Fnbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Fnbp1l APN 3 122549249 missense possibly damaging 0.81
IGL01655:Fnbp1l APN 3 122568749 splice site probably null
IGL01750:Fnbp1l APN 3 122544677 nonsense probably null
IGL02040:Fnbp1l APN 3 122570953 splice site probably benign
IGL02187:Fnbp1l APN 3 122568800 nonsense probably null
IGL03334:Fnbp1l APN 3 122557949 missense probably benign 0.00
R0347:Fnbp1l UTSW 3 122590175 missense probably damaging 1.00
R0382:Fnbp1l UTSW 3 122570953 splice site probably benign
R1401:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R1746:Fnbp1l UTSW 3 122556491 missense probably benign
R1778:Fnbp1l UTSW 3 122590147 missense possibly damaging 0.89
R1861:Fnbp1l UTSW 3 122560932 missense probably damaging 1.00
R2202:Fnbp1l UTSW 3 122546962 missense probably benign 0.00
R3434:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R3947:Fnbp1l UTSW 3 122544579 missense possibly damaging 0.78
R4667:Fnbp1l UTSW 3 122556567 missense probably benign 0.04
R4771:Fnbp1l UTSW 3 122558103 missense possibly damaging 0.54
R4858:Fnbp1l UTSW 3 122546315 missense probably benign 0.30
R5163:Fnbp1l UTSW 3 122544663 missense probably benign 0.00
R6151:Fnbp1l UTSW 3 122570930 missense possibly damaging 0.89
R6153:Fnbp1l UTSW 3 122559156 missense probably benign 0.01
R6452:Fnbp1l UTSW 3 122544549 missense probably damaging 1.00
R6458:Fnbp1l UTSW 3 122556440 missense probably damaging 0.96
R6788:Fnbp1l UTSW 3 122546307 nonsense probably null
R7397:Fnbp1l UTSW 3 122544637 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAAAGGTATTGGCATATGTTGGAC -3'
(R):5'- CTGCCCATTATCAGTGTGTGC -3'

Sequencing Primer
(F):5'- AGGTATTGGCATATGTTGGACTATGG -3'
(R):5'- GCCCATTATCAGTGTGTGCTTTCC -3'
Posted On2015-01-23