Incidental Mutation 'R3407:Vmn1r21'
ID258312
Institutional Source Beutler Lab
Gene Symbol Vmn1r21
Ensembl Gene ENSMUSG00000115343
Gene Namevomeronasal 1 receptor 21
SynonymsV1rc28
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57842830-57850343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57843892 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 189 (G189D)
Ref Sequence ENSEMBL: ENSMUSP00000154295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081186] [ENSMUST00000203310] [ENSMUST00000203488] [ENSMUST00000226191]
Predicted Effect probably damaging
Transcript: ENSMUST00000081186
AA Change: G189D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079950
Gene: ENSMUSG00000058588
AA Change: G189D

DomainStartEndE-ValueType
Pfam:V1R 28 293 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203270
Predicted Effect probably damaging
Transcript: ENSMUST00000203310
AA Change: G189D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145398
Gene: ENSMUSG00000115343
AA Change: G189D

DomainStartEndE-ValueType
Pfam:V1R 27 107 1.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203488
AA Change: G189D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144978
Gene: ENSMUSG00000115343
AA Change: G189D

DomainStartEndE-ValueType
Pfam:V1R 28 105 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226191
AA Change: G189D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Vmn1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Vmn1r21 APN 6 57844064 missense probably benign 0.05
IGL01366:Vmn1r21 APN 6 57843814 missense probably benign 0.01
IGL01660:Vmn1r21 APN 6 57844237 missense probably damaging 0.99
IGL02864:Vmn1r21 APN 6 57843676 missense probably benign 0.13
IGL02961:Vmn1r21 APN 6 57843989 missense probably benign 0.01
IGL03170:Vmn1r21 APN 6 57843862 missense probably damaging 0.99
PIT4453001:Vmn1r21 UTSW 6 57844322 missense probably benign 0.04
R1800:Vmn1r21 UTSW 6 57843814 missense probably benign 0.01
R1928:Vmn1r21 UTSW 6 57844092 nonsense probably null
R5566:Vmn1r21 UTSW 6 57844094 missense probably benign 0.06
R6012:Vmn1r21 UTSW 6 57843906 missense probably damaging 1.00
R6293:Vmn1r21 UTSW 6 57844270 missense probably benign 0.19
R6473:Vmn1r21 UTSW 6 57843598 missense probably damaging 0.99
R7128:Vmn1r21 UTSW 6 57843951 missense probably damaging 0.97
R7489:Vmn1r21 UTSW 6 57843892 missense probably damaging 1.00
R7559:Vmn1r21 UTSW 6 57844242 missense probably damaging 0.99
R8002:Vmn1r21 UTSW 6 57844214 missense probably benign 0.00
Z1176:Vmn1r21 UTSW 6 57843578 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAGTCCACCCAGTACATGAC -3'
(R):5'- TCCAGGCTGTCACAATCAG -3'

Sequencing Primer
(F):5'- TGACCACAAAGAAAACTACCAGGAG -3'
(R):5'- ACAATCAGTCCCAATACCTTCTTG -3'
Posted On2015-01-23