Incidental Mutation 'R3407:Smco3'
ID258313
Institutional Source Beutler Lab
Gene Symbol Smco3
Ensembl Gene ENSMUSG00000043298
Gene Namesingle-pass membrane protein with coiled-coil domains 3
SynonymsC030030A07Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136829927-136835452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136831427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 150 (S150P)
Ref Sequence ENSEMBL: ENSMUSP00000144838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052702] [ENSMUST00000068293] [ENSMUST00000111894] [ENSMUST00000116514] [ENSMUST00000146348] [ENSMUST00000203468] [ENSMUST00000203499] [ENSMUST00000204086] [ENSMUST00000204272]
Predicted Effect probably benign
Transcript: ENSMUST00000052702
SMART Domains Protein: ENSMUSP00000049512
Gene: ENSMUSG00000047515

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068293
AA Change: S150P

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066235
Gene: ENSMUSG00000043298
AA Change: S150P

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 1.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111894
AA Change: S150P

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107525
Gene: ENSMUSG00000043298
AA Change: S150P

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 2.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116514
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141598
Predicted Effect probably benign
Transcript: ENSMUST00000146348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151333
Predicted Effect probably benign
Transcript: ENSMUST00000203468
AA Change: S150P

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144838
Gene: ENSMUSG00000043298
AA Change: S150P

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 2.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203499
SMART Domains Protein: ENSMUSP00000145015
Gene: ENSMUSG00000047515

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204086
Predicted Effect probably benign
Transcript: ENSMUST00000204272
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205058
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Smco3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02037:Smco3 APN 6 136831199 makesense probably null
R1928:Smco3 UTSW 6 136831847 nonsense probably null
R4348:Smco3 UTSW 6 136831694 missense possibly damaging 0.81
R4735:Smco3 UTSW 6 136831638 missense probably damaging 1.00
R5744:Smco3 UTSW 6 136831765 missense probably damaging 1.00
R7716:Smco3 UTSW 6 136831249 missense probably damaging 1.00
X0066:Smco3 UTSW 6 136831534 missense probably damaging 1.00
Z1177:Smco3 UTSW 6 136831693 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCTTAGCTGGCGCTTCACAG -3'
(R):5'- AGCCAACCCTTTATAGGAAGCTG -3'

Sequencing Primer
(F):5'- CCTCAGTGATAGCATGATGGTAC -3'
(R):5'- TTATAGGAAGCTGCAGGATATTAAGG -3'
Posted On2015-01-23