Incidental Mutation 'R3407:Pus3'
ID258324
Institutional Source Beutler Lab
Gene Symbol Pus3
Ensembl Gene ENSMUSG00000032103
Gene Namepseudouridine synthase 3
Synonyms5730412F04Rik, 2610020J05Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35558595-35567401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35566725 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 418 (R418C)
Ref Sequence ENSEMBL: ENSMUSP00000034615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034615] [ENSMUST00000098906] [ENSMUST00000115110] [ENSMUST00000121246]
Predicted Effect probably damaging
Transcript: ENSMUST00000034615
AA Change: R418C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103
AA Change: R418C

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098906
SMART Domains Protein: ENSMUSP00000096505
Gene: ENSMUSG00000074452

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115110
SMART Domains Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Pfam:HYLS1_C 211 299 6.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121246
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135768
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of tRNA pseudouridine from tRNA uridine at position 39 in the anticodon stem and loop of transfer RNAs. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Pus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Pus3 UTSW 9 35566624 missense probably benign
R0018:Pus3 UTSW 9 35566624 missense probably benign
R0376:Pus3 UTSW 9 35566422 missense possibly damaging 0.51
R0927:Pus3 UTSW 9 35565031 missense probably damaging 1.00
R3766:Pus3 UTSW 9 35566672 missense probably benign 0.01
R3832:Pus3 UTSW 9 35566578 missense probably benign 0.37
R3833:Pus3 UTSW 9 35566578 missense probably benign 0.37
R4655:Pus3 UTSW 9 35564932 missense probably benign 0.00
R5085:Pus3 UTSW 9 35565636 missense possibly damaging 0.93
R7238:Pus3 UTSW 9 35566669 missense probably benign
R7807:Pus3 UTSW 9 35566725 missense probably damaging 1.00
X0027:Pus3 UTSW 9 35566456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACATGCTATATAGTATGCTGCAAG -3'
(R):5'- CCCTGGATCCTGTTAGAGATGC -3'

Sequencing Primer
(F):5'- ATGCTGCAAGGTCTAGACTC -3'
(R):5'- AGGCTTCCTAGGATTATGCAATGC -3'
Posted On2015-01-23