Incidental Mutation 'R3407:Fam212a'
ID258327
Institutional Source Beutler Lab
Gene Symbol Fam212a
Ensembl Gene ENSMUSG00000042106
Gene Namefamily with sequence similarity 212, member A
SynonymsInka1, 6230427J02Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107984223-107985879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107985054 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 23 (R23Q)
Ref Sequence ENSEMBL: ENSMUSP00000134980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000048568] [ENSMUST00000175914] [ENSMUST00000177368] [ENSMUST00000177392]
Predicted Effect probably benign
Transcript: ENSMUST00000035216
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000048568
AA Change: R21Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040433
Gene: ENSMUSG00000042106
AA Change: R21Q

DomainStartEndE-ValueType
low complexity region 52 73 N/A INTRINSIC
Pfam:FAM212 146 201 1.7e-30 PFAM
low complexity region 228 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158330
Predicted Effect probably damaging
Transcript: ENSMUST00000175914
AA Change: R23Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134980
Gene: ENSMUSG00000042106
AA Change: R23Q

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177392
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: A small percentage of homozygous null mice display exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Fam212a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fam212a APN 9 107984457 missense probably damaging 1.00
R1803:Fam212a UTSW 9 107984739 missense probably benign 0.06
R2860:Fam212a UTSW 9 107984404 missense probably benign
R2861:Fam212a UTSW 9 107984404 missense probably benign
R7387:Fam212a UTSW 9 107984427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACATCCCAAGGGTAAACC -3'
(R):5'- CCTAAAGAAGTGCTGTGCTGC -3'

Sequencing Primer
(F):5'- GTAAACCCTTGTCTTCTGCTACCAAG -3'
(R):5'- CTGTGCTGCTGTGGACATCC -3'
Posted On2015-01-23