Incidental Mutation 'R3407:Eif4a1'
ID258332
Institutional Source Beutler Lab
Gene Symbol Eif4a1
Ensembl Gene ENSMUSG00000059796
Gene Nameeukaryotic translation initiation factor 4A1
Synonymsinitiation factor eIF-4A long form, Eif4
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69666936-69672423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69670263 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 72 (V72E)
Ref Sequence ENSEMBL: ENSMUSP00000127034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018918] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000108654] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018918
SMART Domains Protein: ENSMUSP00000018918
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lamp 28 326 5.6e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066760
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083928
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect probably benign
Transcript: ENSMUST00000108654
SMART Domains Protein: ENSMUSP00000104294
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
Pfam:Lamp 16 335 3.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133067
Predicted Effect probably benign
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158917
Predicted Effect probably damaging
Transcript: ENSMUST00000163666
AA Change: V72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796
AA Change: V72E

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Eif4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Eif4a1 APN 11 69669096 missense probably damaging 0.99
IGL01923:Eif4a1 APN 11 69672303 missense possibly damaging 0.81
Tour UTSW 11 69670664 missense probably damaging 0.99
R0709:Eif4a1 UTSW 11 69670252 missense probably damaging 1.00
R4361:Eif4a1 UTSW 11 69667464 utr 3 prime probably benign
R4398:Eif4a1 UTSW 11 69669244 missense possibly damaging 0.62
R4896:Eif4a1 UTSW 11 69668597 intron probably benign
R4936:Eif4a1 UTSW 11 69672425 unclassified probably benign
R4941:Eif4a1 UTSW 11 69667814 intron probably benign
R6366:Eif4a1 UTSW 11 69670955 missense probably benign
R7077:Eif4a1 UTSW 11 69670664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACAATGTCCTCAACCTTCTTC -3'
(R):5'- CTAGTCTAACAAGCTGTTGTGAGTTC -3'

Sequencing Primer
(F):5'- GTAAACGTCATAGTACTGGCTGTCC -3'
(R):5'- CTGTTGTGAGTTCATAATATTTTGGC -3'
Posted On2015-01-23