Incidental Mutation 'R3407:Ints6'
ID258336
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Nameintegrator complex subunit 6
SynonymsDICE1, Notch2l, Ddx26, 2900075H24Rik
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location62676330-62761169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62696937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 707 (I707K)
Ref Sequence ENSEMBL: ENSMUSP00000152954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000171692] [ENSMUST00000223585]
Predicted Effect probably benign
Transcript: ENSMUST00000053959
AA Change: I707K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: I707K

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171692
SMART Domains Protein: ENSMUSP00000125769
Gene: ENSMUSG00000091155

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 37 399 4.76e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223585
AA Change: I707K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62703179 missense probably damaging 1.00
IGL00763:Ints6 APN 14 62700865 splice site probably benign
IGL01624:Ints6 APN 14 62696871 missense probably benign 0.07
IGL01721:Ints6 APN 14 62713739 missense probably damaging 0.96
IGL02146:Ints6 APN 14 62759260 missense possibly damaging 0.91
R0302:Ints6 UTSW 14 62709512 missense probably damaging 1.00
R0320:Ints6 UTSW 14 62707635 nonsense probably null
R0543:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R0554:Ints6 UTSW 14 62704751 missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62696759 missense probably benign
R0960:Ints6 UTSW 14 62709566 missense probably benign 0.39
R1216:Ints6 UTSW 14 62707698 missense probably damaging 1.00
R1254:Ints6 UTSW 14 62716374 missense probably benign 0.27
R1296:Ints6 UTSW 14 62704903 splice site probably benign
R1548:Ints6 UTSW 14 62713692 missense probably damaging 1.00
R1944:Ints6 UTSW 14 62693640 missense probably benign 0.03
R2040:Ints6 UTSW 14 62713689 missense probably damaging 0.99
R2279:Ints6 UTSW 14 62704682 critical splice donor site probably null
R2844:Ints6 UTSW 14 62704826 missense probably damaging 0.97
R3107:Ints6 UTSW 14 62760592 missense possibly damaging 0.92
R3895:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R4608:Ints6 UTSW 14 62703229 missense probably damaging 1.00
R4903:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4964:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4966:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R5014:Ints6 UTSW 14 62760191 missense probably benign 0.00
R5369:Ints6 UTSW 14 62743935 missense probably damaging 1.00
R6478:Ints6 UTSW 14 62700786 missense probably benign 0.37
R7022:Ints6 UTSW 14 62714337 missense probably damaging 1.00
R7403:Ints6 UTSW 14 62707655 missense possibly damaging 0.50
R7422:Ints6 UTSW 14 62704775 missense probably benign
R7909:Ints6 UTSW 14 62759330 missense probably damaging 0.99
R7990:Ints6 UTSW 14 62759330 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGGTATATTCTCTTCGGCAC -3'
(R):5'- AGGTAGGTAGGACTCTTAAGCC -3'

Sequencing Primer
(F):5'- GGCTCCTCATGATTTTCTAAAAACC -3'
(R):5'- TAGGTAGGACTCTTAAGCCAAAAATG -3'
Posted On2015-01-23