Incidental Mutation 'R0328:Wnt4'
ID25834
Institutional Source Beutler Lab
Gene Symbol Wnt4
Ensembl Gene ENSMUSG00000036856
Gene Namewingless-type MMTV integration site family, member 4
SynonymsWnt-4
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0328 (G1)
Quality Score205
Status Validated
Chromosome4
Chromosomal Location137277489-137299726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137295443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000036580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045747]
Predicted Effect probably damaging
Transcript: ENSMUST00000045747
AA Change: T106A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036580
Gene: ENSMUSG00000036856
AA Change: T106A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 45 350 1.7e-211 SMART
Meta Mutation Damage Score 0.9262 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and is the first signaling molecule shown to influence the sex-determination cascade. It encodes a protein which shows 98% amino acid identity to the Wnt4 protein of mouse and rat. This gene and a nuclear receptor known to antagonize the testis-determining factor play a concerted role in both the control of female development and the prevention of testes formation. This gene and another two family members, WNT2 and WNT7B, may be associated with abnormal proliferation in breast tissue. Mutations in this gene can result in Rokitansky-Kuster-Hauser syndrome and in SERKAL syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired development of the kidney, pituitary gland, and female reproductive system. Mutants die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Wnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03037:Wnt4 APN 4 137289161 missense possibly damaging 0.93
R0791:Wnt4 UTSW 4 137289283 missense probably damaging 1.00
R2332:Wnt4 UTSW 4 137296520 missense probably benign 0.04
R4206:Wnt4 UTSW 4 137296343 missense possibly damaging 0.91
R5269:Wnt4 UTSW 4 137277750 missense probably benign 0.00
X0064:Wnt4 UTSW 4 137277746 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGAACCAGGACCTACTGTGTGCTC -3'
(R):5'- TGCCAGCCTCGTTGTTGTGAAG -3'

Sequencing Primer
(F):5'- CTACTGTGTGCTCGGCAGG -3'
(R):5'- GAGCATCCTGACCACTGGAAG -3'
Posted On2013-04-16