Incidental Mutation 'R3407:Cacnb3'
ID258340
Institutional Source Beutler Lab
Gene Symbol Cacnb3
Ensembl Gene ENSMUSG00000003352
Gene Namecalcium channel, voltage-dependent, beta 3 subunit
SynonymsCchb3, Beta3
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R3407 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98630840-98644529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98641187 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000104778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003442] [ENSMUST00000003450] [ENSMUST00000109150] [ENSMUST00000230490]
Predicted Effect probably benign
Transcript: ENSMUST00000003442
SMART Domains Protein: ENSMUSP00000003442
Gene: ENSMUSG00000003352

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 58 8.7e-22 PFAM
SH3 62 125 1.04e0 SMART
GuKc 176 357 1.3e-32 SMART
low complexity region 363 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000003450
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109150
AA Change: V167A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104778
Gene: ENSMUSG00000003352
AA Change: V167A

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 15 57 2.2e-21 PFAM
SH3 61 124 1.04e0 SMART
GuKc 175 356 1.3e-32 SMART
low complexity region 362 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230064
Predicted Effect probably benign
Transcript: ENSMUST00000230490
AA Change: V168A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230769
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a null allele show altered Ca2+ channel activity, hyporesponsiveness to DHP, high blood pressure on a high salt diet, and impaired calcium responses and cytokine production in CD4 T cells. Homozygotes for another null allele show enhancedNMDA activity and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Cacnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Cacnb3 APN 15 98642002 nonsense probably null
IGL01298:Cacnb3 APN 15 98639853 missense probably damaging 1.00
IGL01535:Cacnb3 APN 15 98639588 missense probably benign 0.02
IGL01537:Cacnb3 APN 15 98643420 missense probably damaging 1.00
IGL02304:Cacnb3 APN 15 98642382 missense probably damaging 1.00
IGL02349:Cacnb3 APN 15 98640961 nonsense probably null
R0270:Cacnb3 UTSW 15 98642559 missense probably damaging 0.98
R1677:Cacnb3 UTSW 15 98642574 missense probably damaging 1.00
R3408:Cacnb3 UTSW 15 98641187 missense probably benign 0.19
R4160:Cacnb3 UTSW 15 98640720 missense probably damaging 1.00
R5123:Cacnb3 UTSW 15 98639869 missense probably damaging 1.00
R5356:Cacnb3 UTSW 15 98641617 missense probably damaging 0.96
R7773:Cacnb3 UTSW 15 98639938 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGAGAGCCTGTTACCTCC -3'
(R):5'- GGACAGTGTCCCCAAGTAGAG -3'

Sequencing Primer
(F):5'- TTTCCTTTTCCAAAAAGCCAAGCAG -3'
(R):5'- GTGTCCCCAAGTAGAGTTCAC -3'
Posted On2015-01-23