Incidental Mutation 'R3407:Adgrg4'
ID258347
Institutional Source Beutler Lab
Gene Symbol Adgrg4
Ensembl Gene ENSMUSG00000053852
Gene Nameadhesion G protein-coupled receptor G4
SynonymsGpr112, LOC236798, PGR17
MMRRC Submission 040625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3407 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location56870163-57001558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56968127 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2838 (I2838F)
Ref Sequence ENSEMBL: ENSMUSP00000116634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096431] [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818]
Predicted Effect probably benign
Transcript: ENSMUST00000096431
SMART Domains Protein: ENSMUSP00000094165
Gene: ENSMUSG00000053852

DomainStartEndE-ValueType
Pfam:7tm_2 1 75 1.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136396
AA Change: I2591F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: I2591F

DomainStartEndE-ValueType
SCOP:d1saca_ 2 159 5e-14 SMART
low complexity region 242 261 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
internal_repeat_1 459 720 5.68e-5 PROSPERO
internal_repeat_1 719 999 5.68e-5 PROSPERO
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1079 1101 N/A INTRINSIC
low complexity region 1243 1261 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1536 1550 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1843 1864 N/A INTRINSIC
low complexity region 1892 1911 N/A INTRINSIC
low complexity region 1953 1970 N/A INTRINSIC
low complexity region 2068 2076 N/A INTRINSIC
low complexity region 2257 2269 N/A INTRINSIC
GPS 2384 2436 1.79e-18 SMART
Pfam:7tm_2 2443 2684 4.8e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145035
AA Change: I3F
SMART Domains Protein: ENSMUSP00000122908
Gene: ENSMUSG00000053852
AA Change: I3F

DomainStartEndE-ValueType
Pfam:7tm_2 1 97 7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153784
AA Change: I2838F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: I2838F

DomainStartEndE-ValueType
SCOP:d1saca_ 28 222 1e-17 SMART
low complexity region 305 324 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
internal_repeat_1 522 783 2.5e-5 PROSPERO
internal_repeat_1 782 1062 2.5e-5 PROSPERO
low complexity region 1076 1087 N/A INTRINSIC
low complexity region 1114 1129 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1306 1324 N/A INTRINSIC
low complexity region 1409 1420 N/A INTRINSIC
low complexity region 1599 1613 N/A INTRINSIC
low complexity region 1643 1659 N/A INTRINSIC
low complexity region 1906 1927 N/A INTRINSIC
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 2016 2033 N/A INTRINSIC
low complexity region 2131 2139 N/A INTRINSIC
low complexity region 2289 2300 N/A INTRINSIC
low complexity region 2459 2471 N/A INTRINSIC
GPS 2631 2683 1.79e-18 SMART
Pfam:7tm_2 2691 2932 8.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154818
AA Change: I2633F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: I2633F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 100 119 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
internal_repeat_1 317 578 4.23e-5 PROSPERO
internal_repeat_1 577 857 4.23e-5 PROSPERO
low complexity region 871 882 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 937 959 N/A INTRINSIC
low complexity region 1101 1119 N/A INTRINSIC
low complexity region 1204 1215 N/A INTRINSIC
low complexity region 1394 1408 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1701 1722 N/A INTRINSIC
low complexity region 1750 1769 N/A INTRINSIC
low complexity region 1811 1828 N/A INTRINSIC
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 2084 2095 N/A INTRINSIC
low complexity region 2254 2266 N/A INTRINSIC
GPS 2426 2478 1.79e-18 SMART
Pfam:7tm_2 2485 2727 3.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 G A 2: 90,791,618 V150I probably damaging Het
Ambra1 T C 2: 91,910,307 S924P probably damaging Het
Arfgap3 T C 15: 83,322,607 D260G probably benign Het
Bag3 TAAAG TAAAGAAAG 7: 128,545,768 probably null Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Carm1 C T 9: 21,586,182 R347W probably damaging Het
Ccdc30 A T 4: 119,324,581 F577I possibly damaging Het
Ces3a T A 8: 105,050,567 V174E probably damaging Het
Cobl T C 11: 12,375,830 Y215C probably damaging Het
Cybrd1 A T 2: 71,118,126 M3L probably damaging Het
Dis3 A G 14: 99,098,776 V98A probably benign Het
Dsg1c G A 18: 20,282,058 probably null Het
Eif4a1 A T 11: 69,670,263 V72E probably damaging Het
Fam212a C T 9: 107,985,054 R23Q probably damaging Het
Fmn1 A T 2: 113,365,055 I367F unknown Het
Fnbp1l A C 3: 122,552,150 W229G probably damaging Het
Ints6 A T 14: 62,696,937 I707K probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Kif20b T C 19: 34,950,500 L1014P probably damaging Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Mbd1 A G 18: 74,277,367 K414E possibly damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mthfr T C 4: 148,055,061 I66T probably damaging Het
Myh10 T G 11: 68,790,211 L989R possibly damaging Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Olfr1115 A C 2: 87,252,899 T321P probably benign Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Pate2 C T 9: 35,670,966 T80I probably damaging Het
Pcdhb15 A G 18: 37,474,389 T225A possibly damaging Het
Pde4dip C A 3: 97,754,468 L640F probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Pus3 C T 9: 35,566,725 R418C probably damaging Het
Sall2 G T 14: 52,328,104 N24K probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Smco3 A G 6: 136,831,427 S150P probably benign Het
Spag17 G T 3: 100,085,299 A1704S probably benign Het
Tecta A T 9: 42,337,854 I1904N probably damaging Het
Ttn T A 2: 76,705,937 K33280* probably null Het
Uggt2 T C 14: 119,091,270 D90G probably benign Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Zbtb10 A G 3: 9,264,866 N428S probably damaging Het
Zfp407 G A 18: 84,558,872 A1372V probably benign Het
Other mutations in Adgrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Adgrg4 APN X 56977596 missense probably damaging 1.00
R3408:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3947:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R3948:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R4067:Adgrg4 UTSW X 56959960 missense probably damaging 1.00
R4207:Adgrg4 UTSW X 56918749 missense possibly damaging 0.92
R4393:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4395:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4397:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4504:Adgrg4 UTSW X 56916442 missense possibly damaging 0.63
Z1176:Adgrg4 UTSW X 56894702 missense probably benign 0.00
Z1176:Adgrg4 UTSW X 56914259 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGACACAAGCTTCCATTGTATG -3'
(R):5'- AAACTGATTGTGCCTTTGAGGTC -3'

Sequencing Primer
(F):5'- CCATTGTATGGTACTAGAAGTAGGGC -3'
(R):5'- GCCTTTGAGGTCATTCAGGATC -3'
Posted On2015-01-23