Incidental Mutation 'R3408:Mroh2a'
ID258349
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R3408 (G1)
Quality Score159
Status Not validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCC to GC at 88232257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88234612 critical splice donor site probably null
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATATGCCCTTGAGCAGACATG -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- AGTTCACCCTTTTTAAACATGTGGC -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'
Posted On2015-01-23