Incidental Mutation 'R3408:Mroh2a'
ID 258349
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Name maestro heat-like repeat family member 2A
Synonyms ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
MMRRC Submission 040626-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R3408 (G1)
Quality Score 159
Status Not validated
Chromosome 1
Chromosomal Location 88154713-88190011 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCCC to GC at 88159979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
AlphaFold D3Z750
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 155,845,840 (GRCm39) V6I probably benign Het
Adam17 T A 12: 21,379,119 (GRCm39) K643N probably damaging Het
Adgrg4 A T X: 56,013,487 (GRCm39) I2838F probably damaging Het
Aox1 G A 1: 58,382,827 (GRCm39) V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,147,493 (GRCm39) probably null Het
Cacnb3 T C 15: 98,539,068 (GRCm39) V167A probably benign Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
E2f7 C T 10: 110,620,578 (GRCm39) T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Ephb3 T A 16: 21,038,254 (GRCm39) Y341N probably damaging Het
Frem1 A T 4: 82,930,223 (GRCm39) V241E probably damaging Het
Gpi1 A G 7: 33,902,104 (GRCm39) V500A probably damaging Het
Ilk A T 7: 105,390,181 (GRCm39) M155L probably benign Het
Ipo8 T C 6: 148,723,207 (GRCm39) D70G probably benign Het
Macf1 T C 4: 123,275,574 (GRCm39) Q6283R probably damaging Het
Mfsd1 T A 3: 67,504,046 (GRCm39) M346K possibly damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Myo7a A T 7: 97,730,294 (GRCm39) F758Y probably benign Het
Nalcn T A 14: 123,834,029 (GRCm39) S49C probably null Het
Ncan G A 8: 70,564,801 (GRCm39) T271I probably damaging Het
Nr5a2 C T 1: 136,868,236 (GRCm39) A299T probably benign Het
Or10ag60 A T 2: 87,438,220 (GRCm39) I163L probably benign Het
Or4g16 A T 2: 111,136,850 (GRCm39) Q100L probably damaging Het
Or51q1c G T 7: 103,652,550 (GRCm39) E23* probably null Het
Or9s23 A G 1: 92,501,675 (GRCm39) T261A probably damaging Het
Piwil4 T C 9: 14,637,259 (GRCm39) T352A probably damaging Het
Plch1 A G 3: 63,606,768 (GRCm39) probably benign Het
Plekhg5 A G 4: 152,192,749 (GRCm39) T559A probably damaging Het
Rfx2 G T 17: 57,110,526 (GRCm39) D153E probably benign Het
Sh3bp4 G T 1: 89,072,769 (GRCm39) C539F possibly damaging Het
Slco1b2 A T 6: 141,621,982 (GRCm39) H479L probably benign Het
Spmip9 C T 6: 70,892,690 (GRCm39) S19N possibly damaging Het
Tmem150b G T 7: 4,727,339 (GRCm39) F55L probably damaging Het
Vmn1r60 A T 7: 5,548,148 (GRCm39) probably null Het
Vmn2r80 C T 10: 79,004,227 (GRCm39) L147F possibly damaging Het
Vps50 A T 6: 3,600,212 (GRCm39) K890N probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88,172,692 (GRCm39) missense probably benign 0.03
IGL00990:Mroh2a APN 1 88,161,842 (GRCm39) missense possibly damaging 0.76
IGL00990:Mroh2a APN 1 88,158,468 (GRCm39) missense probably damaging 0.99
IGL03097:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R0032:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0068:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0139:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0374:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R0536:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0548:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0583:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0613:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0657:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88,156,102 (GRCm39) missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0689:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0735:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0845:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0853:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0959:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R0960:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1028:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1268:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1281:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
R1414:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1439:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88,169,353 (GRCm39) missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88,160,075 (GRCm39) splice site probably benign
R1442:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R1686:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1686:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1780:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1846:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1899:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1958:Mroh2a UTSW 1 88,165,213 (GRCm39) nonsense probably null
R2122:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2248:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2306:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R2869:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2870:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2871:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3608:Mroh2a UTSW 1 88,172,717 (GRCm39) missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3937:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4022:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4133:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88,187,311 (GRCm39) missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4625:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4665:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4701:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R4701:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4771:Mroh2a UTSW 1 88,179,087 (GRCm39) missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4839:Mroh2a UTSW 1 88,165,666 (GRCm39) missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R5007:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5031:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5062:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5301:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5367:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5446:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5506:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5561:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5615:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5825:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R5891:Mroh2a UTSW 1 88,169,337 (GRCm39) missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5928:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R6004:Mroh2a UTSW 1 88,176,377 (GRCm39) missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88,158,390 (GRCm39) missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6074:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R6091:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6127:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6234:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6234:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6244:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6464:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6575:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6809:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R6819:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R8350:Mroh2a UTSW 1 88,171,805 (GRCm39) splice site probably null
R9414:Mroh2a UTSW 1 88,179,096 (GRCm39) missense probably benign 0.26
RF024:Mroh2a UTSW 1 88,170,207 (GRCm39) missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88,154,813 (GRCm39) start gained probably benign
V8831:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
X0027:Mroh2a UTSW 1 88,176,335 (GRCm39) missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0028:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0033:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,160,014 (GRCm39) missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0039:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,377 (GRCm39) missense probably benign 0.25
X0057:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0063:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1188:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1192:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATATGCCCTTGAGCAGACATG -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- AGTTCACCCTTTTTAAACATGTGGC -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'
Posted On 2015-01-23