Incidental Mutation 'R3408:Sh3bp4'
ID258350
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene NameSH3-domain binding protein 4
SynonymsBOG25
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3408 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location89070415-89155068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89145047 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 539 (C539F)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066279
AA Change: C539F

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: C539F

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89145592 missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R5908:Sh3bp4 UTSW 1 89145883 missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89153166 missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 intron probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCTCTATGGTCCCAAACAC -3'
(R):5'- CGGAGTCTGGACACAAAACTG -3'

Sequencing Primer
(F):5'- CATCCATCCATCCTTCAAGACAGTAG -3'
(R):5'- CAAAACTGCGTGAGGATCGTGTC -3'
Posted On2015-01-23