Incidental Mutation 'R3408:Tmem150b'
ID258368
Institutional Source Beutler Lab
Gene Symbol Tmem150b
Ensembl Gene ENSMUSG00000046456
Gene Nametransmembrane protein 150B
SynonymsTmem224
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3408 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4706832-4725249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4724340 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 55 (F55L)
Ref Sequence ENSEMBL: ENSMUSP00000083550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086363] [ENSMUST00000086364]
Predicted Effect probably damaging
Transcript: ENSMUST00000086363
AA Change: F55L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083549
Gene: ENSMUSG00000046456
AA Change: F55L

DomainStartEndE-ValueType
Pfam:Frag1 4 207 7.1e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086364
AA Change: F55L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083550
Gene: ENSMUSG00000046456
AA Change: F55L

DomainStartEndE-ValueType
Pfam:Frag1 4 114 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the DRAM (damage-regulated autophagy modulator) family of membrane-spanning proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Tmem150b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tmem150b APN 7 4723897 missense probably benign 0.01
R1769:Tmem150b UTSW 7 4724366 missense probably damaging 1.00
R1888:Tmem150b UTSW 7 4709045 missense probably benign 0.31
R1888:Tmem150b UTSW 7 4709045 missense probably benign 0.31
R2197:Tmem150b UTSW 7 4716354 missense probably benign 0.07
R3872:Tmem150b UTSW 7 4724361 nonsense probably null
R4820:Tmem150b UTSW 7 4723872 missense probably damaging 1.00
R5412:Tmem150b UTSW 7 4716369 missense probably null 0.54
R6280:Tmem150b UTSW 7 4724374 missense probably benign 0.00
R7427:Tmem150b UTSW 7 4716210 missense probably benign 0.29
R7658:Tmem150b UTSW 7 4720759 missense probably benign 0.00
R8015:Tmem150b UTSW 7 4716328 missense probably null 1.00
R8209:Tmem150b UTSW 7 4720692 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGACTCTGGGTCTGAGAG -3'
(R):5'- CAATCGCTGTGGTTAATGGTTC -3'

Sequencing Primer
(F):5'- CTAGACTCCTGGGTGTGAGGAAG -3'
(R):5'- TTCTGTGGACCTCAACGAAG -3'
Posted On2015-01-23