Incidental Mutation 'R3408:Olfr638'
ID 258374
Institutional Source Beutler Lab
Gene Symbol Olfr638
Ensembl Gene ENSMUSG00000094063
Gene Name olfactory receptor 638
Synonyms MOR5-1, GA_x6K02T2PBJ9-6737723-6738670
MMRRC Submission 040626-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R3408 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103998746-104004357 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 104003343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 23 (E23*)
Ref Sequence ENSEMBL: ENSMUSP00000151996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138055] [ENSMUST00000209757] [ENSMUST00000215653] [ENSMUST00000218325]
AlphaFold Q8VH20
Predicted Effect probably null
Transcript: ENSMUST00000098184
AA Change: E29*
SMART Domains Protein: ENSMUSP00000095786
Gene: ENSMUSG00000094063
AA Change: E29*

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 2.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 198 9.8e-10 PFAM
Pfam:7tm_1 49 300 7.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209757
AA Change: E29*
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect probably null
Transcript: ENSMUST00000218325
AA Change: E23*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Olfr638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Olfr638 APN 7 104003635 missense probably damaging 1.00
IGL01901:Olfr638 APN 7 104004067 missense probably damaging 1.00
IGL02040:Olfr638 APN 7 104003407 missense probably damaging 1.00
IGL02756:Olfr638 APN 7 104003659 missense probably damaging 1.00
R0122:Olfr638 UTSW 7 104003358 missense probably damaging 1.00
R0137:Olfr638 UTSW 7 104003502 missense probably benign 0.13
R0312:Olfr638 UTSW 7 104004025 missense probably damaging 1.00
R0650:Olfr638 UTSW 7 104003239 splice site probably null
R0652:Olfr638 UTSW 7 104003239 splice site probably null
R1382:Olfr638 UTSW 7 104003720 missense probably benign 0.01
R1700:Olfr638 UTSW 7 104004122 nonsense probably null
R1723:Olfr638 UTSW 7 104003311 missense probably damaging 0.97
R1745:Olfr638 UTSW 7 104004063 missense probably benign 0.02
R1840:Olfr638 UTSW 7 104004117 missense probably benign 0.00
R3413:Olfr638 UTSW 7 104003832 missense probably damaging 0.99
R4441:Olfr638 UTSW 7 104004072 missense probably damaging 1.00
R4727:Olfr638 UTSW 7 104003890 missense probably benign 0.00
R5096:Olfr638 UTSW 7 104003460 missense probably benign 0.08
R5851:Olfr638 UTSW 7 104003452 missense probably benign 0.13
R6133:Olfr638 UTSW 7 104003325 missense possibly damaging 0.58
R6529:Olfr638 UTSW 7 104003926 missense probably benign 0.06
R6572:Olfr638 UTSW 7 103999184 splice site probably null
R6799:Olfr638 UTSW 7 103998799 critical splice donor site probably null
R7267:Olfr638 UTSW 7 104003839 missense probably benign
R9140:Olfr638 UTSW 7 104004115 missense probably damaging 1.00
X0018:Olfr638 UTSW 7 104003431 missense probably benign
X0063:Olfr638 UTSW 7 104003527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGTATTGTACTTCTCAGGGGC -3'
(R):5'- AATGTTGAACCAGAGGACCTG -3'

Sequencing Primer
(F):5'- CTCAGGGGCAATCTGTCATATATAC -3'
(R):5'- CCAGAGGACCTGCATGACTGTAG -3'
Posted On 2015-01-23