Incidental Mutation 'R3408:Bag3'
ID258376
Institutional Source Beutler Lab
Gene Symbol Bag3
Ensembl Gene ENSMUSG00000030847
Gene NameBCL2-associated athanogene 3
SynonymsBcl-2-interacting death suppressor, Bis
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3408 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location128523616-128546981 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAAGG to AAAGGAAGG at 128545769 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033136]
PDB Structure
Solution structure of the Murine BAG domain of Bcl2-associated athanogene 3 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000033136
SMART Domains Protein: ENSMUSP00000033136
Gene: ENSMUSG00000030847

DomainStartEndE-ValueType
WW 23 56 1.49e-11 SMART
internal_repeat_1 90 151 3.37e-5 PROSPERO
low complexity region 158 171 N/A INTRINSIC
low complexity region 176 204 N/A INTRINSIC
internal_repeat_1 206 283 3.37e-5 PROSPERO
low complexity region 372 392 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
BAG 426 503 9.22e-27 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, growth retardation, cardiomyocyte and skeletal myocyte degeneration, and pulmonary edema. Mice homozygous for a null allele also exhibit postnatal lethality and growth retardation but lack the myocyte degeneration phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Bag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Bag3 APN 7 128546341 missense probably benign 0.03
IGL01942:Bag3 APN 7 128546300 missense probably benign 0.00
PIT4377001:Bag3 UTSW 7 128545717 missense probably damaging 1.00
R0577:Bag3 UTSW 7 128523887 missense probably benign 0.00
R1730:Bag3 UTSW 7 128523859 start codon destroyed possibly damaging 0.89
R1991:Bag3 UTSW 7 128545683 missense probably benign
R2065:Bag3 UTSW 7 128545774 missense probably damaging 0.96
R2198:Bag3 UTSW 7 128545769 frame shift probably null
R2201:Bag3 UTSW 7 128545769 frame shift probably null
R3407:Bag3 UTSW 7 128545768 frame shift probably null
R3407:Bag3 UTSW 7 128545769 frame shift probably null
R3765:Bag3 UTSW 7 128540271 missense probably benign 0.30
R4201:Bag3 UTSW 7 128546157 missense probably damaging 1.00
R4430:Bag3 UTSW 7 128523923 missense probably damaging 0.99
R5642:Bag3 UTSW 7 128546106 missense probably damaging 1.00
R6112:Bag3 UTSW 7 128541832 missense probably damaging 0.99
R6298:Bag3 UTSW 7 128540198 missense probably damaging 0.99
R8145:Bag3 UTSW 7 128545888 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATCGAGAGCCTCCACCTGTTAC -3'
(R):5'- CTTGCCTTCAAAGCTGTCTACAG -3'

Sequencing Primer
(F):5'- GAGCCTCCACCTGTTACCCAAC -3'
(R):5'- ACTTTCAGCACACCTGGATG -3'
Posted On2015-01-23