Mutagenetix > Incidental Mutation

Incidental Mutation 'R3408:Ncan'

258378

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

040626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3408 (G1)

Quality Score

156

Status

Not validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70112151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 271 (T271I)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000002412
AA Change: T271I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: T271I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430550D23Rik	C	T	2: 156,003,920	V6I	probably benign	Het
Adam17	T	A	12: 21,329,118	K643N	probably damaging	Het
Adgrg4	A	T	X: 56,968,127	I2838F	probably damaging	Het
Aox2	G	A	1: 58,343,668	V1036I	probably benign	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,545,769		probably null	Het
Cacnb3	T	C	15: 98,641,187	V167A	probably benign	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
E2f7	C	T	10: 110,784,717	T865M	possibly damaging	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Elmsan1	C	T	12: 84,156,471	G886S	probably benign	Het
Ephb3	T	A	16: 21,219,504	Y341N	probably damaging	Het
Frem1	A	T	4: 83,011,986	V241E	probably damaging	Het
Gpi1	A	G	7: 34,202,679	V500A	probably damaging	Het
Ilk	A	T	7: 105,740,974	M155L	probably benign	Het
Ipo8	T	C	6: 148,821,709	D70G	probably benign	Het
Macf1	T	C	4: 123,381,781	Q6283R	probably damaging	Het
Mfsd1	T	A	3: 67,596,713	M346K	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo7a	A	T	7: 98,081,087	F758Y	probably benign	Het
Nalcn	T	A	14: 123,596,617	S49C	probably null	Het
Nr5a2	C	T	1: 136,940,498	A299T	probably benign	Het
Olfr1130	A	T	2: 87,607,876	I163L	probably benign	Het
Olfr1279	A	T	2: 111,306,505	Q100L	probably damaging	Het
Olfr1413	A	G	1: 92,573,953	T261A	probably damaging	Het
Olfr638	G	T	7: 104,003,343	E23*	probably null	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Plch1	A	G	3: 63,699,347		probably benign	Het
Plekhg5	A	G	4: 152,108,292	T559A	probably damaging	Het
Rfx2	G	T	17: 56,803,526	D153E	probably benign	Het
Sh3bp4	G	T	1: 89,145,047	C539F	possibly damaging	Het
Slco1b2	A	T	6: 141,676,256	H479L	probably benign	Het
Tex37	C	T	6: 70,915,706	S19N	possibly damaging	Het
Tmem150b	G	T	7: 4,724,340	F55L	probably damaging	Het
Vmn1r60	A	T	7: 5,545,149		probably null	Het
Vmn2r80	C	T	10: 79,168,393	L147F	possibly damaging	Het
Vps50	A	T	6: 3,600,212	K890N	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCTAACGCACCTCGGAAG -3'
(R):5'- TGCTAAGTCTCCTCAGAAAGC -3'

Sequencing Primer
(F):5'- TAACGCACCTCGGAAGCAGTAG -3'
(R):5'- GTCTCCTCAGAAAGCTCCAAAGTTG -3'

Posted On

2015-01-23