Incidental Mutation 'R3408:Piwil4'
ID258380
Institutional Source Beutler Lab
Gene Symbol Piwil4
Ensembl Gene ENSMUSG00000036912
Gene Namepiwi-like RNA-mediated gene silencing 4
SynonymsMiwi2, 9230101H05Rik, MIWI2
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R3408 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14696230-14740733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14725963 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 352 (T352A)
Ref Sequence ENSEMBL: ENSMUSP00000076213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]
Predicted Effect probably damaging
Transcript: ENSMUST00000076946
AA Change: T352A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: T352A

DomainStartEndE-ValueType
Pfam:ArgoN 155 300 3.7e-11 PFAM
PAZ 313 450 2.55e-67 SMART
Piwi 614 864 8.98e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115644
AA Change: T305A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: T305A

DomainStartEndE-ValueType
Pfam:ArgoN 92 245 6.5e-10 PFAM
PAZ 266 403 2.55e-67 SMART
Piwi 541 834 6.71e-126 SMART
Meta Mutation Damage Score 0.5736 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Piwil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Piwil4 APN 9 14703097 missense probably damaging 1.00
IGL00331:Piwil4 APN 9 14715031 splice site probably benign
IGL00848:Piwil4 APN 9 14727411 missense probably damaging 0.98
IGL00920:Piwil4 APN 9 14727437 missense probably damaging 1.00
IGL01583:Piwil4 APN 9 14734487 missense probably damaging 1.00
IGL01690:Piwil4 APN 9 14703095 missense probably damaging 1.00
IGL01763:Piwil4 APN 9 14706266 unclassified probably null
IGL02103:Piwil4 APN 9 14725986 splice site probably null
IGL02898:Piwil4 APN 9 14706287 unclassified probably benign
IGL03037:Piwil4 APN 9 14705012 missense possibly damaging 0.88
IGL03352:Piwil4 APN 9 14725887 missense probably damaging 1.00
PIT4651001:Piwil4 UTSW 9 14708899 missense possibly damaging 0.48
R0453:Piwil4 UTSW 9 14727452 missense probably benign 0.00
R2324:Piwil4 UTSW 9 14736908 missense possibly damaging 0.88
R3236:Piwil4 UTSW 9 14700248 unclassified probably benign
R3689:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3844:Piwil4 UTSW 9 14729960 missense possibly damaging 0.54
R4191:Piwil4 UTSW 9 14715000 missense probably damaging 0.99
R4505:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4506:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4541:Piwil4 UTSW 9 14718316 missense probably damaging 1.00
R4652:Piwil4 UTSW 9 14712308 nonsense probably null
R4876:Piwil4 UTSW 9 14740465 missense probably benign 0.22
R5027:Piwil4 UTSW 9 14709944 missense probably damaging 1.00
R5479:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R6656:Piwil4 UTSW 9 14709934 missense probably damaging 1.00
R6736:Piwil4 UTSW 9 14715823 missense probably benign
R7096:Piwil4 UTSW 9 14736816 nonsense probably null
R7124:Piwil4 UTSW 9 14736900 missense probably benign
R7358:Piwil4 UTSW 9 14729993 missense possibly damaging 0.82
R7371:Piwil4 UTSW 9 14727433 missense probably benign 0.08
R7419:Piwil4 UTSW 9 14702395 missense probably damaging 1.00
R7467:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R7571:Piwil4 UTSW 9 14734597 missense probably benign 0.08
R7644:Piwil4 UTSW 9 14734415 intron probably null
X0026:Piwil4 UTSW 9 14740591 utr 5 prime probably benign
X0064:Piwil4 UTSW 9 14708875 missense probably benign 0.00
Z1088:Piwil4 UTSW 9 14734517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTTGGAGAGGTCACAACC -3'
(R):5'- TGTGTACTGAAGCGTTCACAC -3'

Sequencing Primer
(F):5'- GGTCACAACCACAAGAAAAGTG -3'
(R):5'- CTCTGTTGAGAGCTGATCCTGC -3'
Posted On2015-01-23