Incidental Mutation 'R3408:Rfx2'
ID258390
Institutional Source Beutler Lab
Gene Symbol Rfx2
Ensembl Gene ENSMUSG00000024206
Gene Nameregulatory factor X, 2 (influences HLA class II expression)
Synonyms5430432H19Rik
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R3408 (G1)
Quality Score194
Status Not validated
Chromosome17
Chromosomal Location56775897-56831008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56803526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 153 (D153E)
Ref Sequence ENSEMBL: ENSMUSP00000084010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]
Predicted Effect probably benign
Transcript: ENSMUST00000002444
AA Change: D153E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: D153E

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000086801
AA Change: D153E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: D153E

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ilk A T 7: 105,740,974 M155L probably benign Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Rfx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Rfx2 APN 17 56783657 missense probably damaging 1.00
IGL01296:Rfx2 APN 17 56808317 start codon destroyed possibly damaging 0.81
IGL01488:Rfx2 APN 17 56805398 missense probably damaging 1.00
IGL01705:Rfx2 APN 17 56785303 missense possibly damaging 0.88
IGL02389:Rfx2 APN 17 56808325 splice site probably benign
IGL02601:Rfx2 APN 17 56785354 missense possibly damaging 0.75
IGL02609:Rfx2 APN 17 56805404 missense probably benign 0.00
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0066:Rfx2 UTSW 17 56786736 splice site probably benign
R0197:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R0370:Rfx2 UTSW 17 56799308 missense probably benign 0.03
R0413:Rfx2 UTSW 17 56784418 splice site probably benign
R0622:Rfx2 UTSW 17 56777071 missense probably damaging 0.99
R0883:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R1429:Rfx2 UTSW 17 56804369 missense probably damaging 0.97
R1439:Rfx2 UTSW 17 56787720 missense probably damaging 1.00
R1569:Rfx2 UTSW 17 56804326 missense possibly damaging 0.63
R1654:Rfx2 UTSW 17 56808263 missense probably benign 0.00
R1751:Rfx2 UTSW 17 56784754 missense probably benign 0.01
R1816:Rfx2 UTSW 17 56808305 nonsense probably null
R2282:Rfx2 UTSW 17 56803722 missense probably damaging 0.99
R3962:Rfx2 UTSW 17 56785302 missense probably damaging 0.99
R4415:Rfx2 UTSW 17 56787733 missense possibly damaging 0.95
R4876:Rfx2 UTSW 17 56784706 missense probably benign 0.00
R4883:Rfx2 UTSW 17 56783747 missense probably damaging 0.98
R5588:Rfx2 UTSW 17 56779890 missense possibly damaging 0.69
R5766:Rfx2 UTSW 17 56803587 missense probably benign 0.02
R5798:Rfx2 UTSW 17 56804362 missense possibly damaging 0.89
R5931:Rfx2 UTSW 17 56780778 missense probably damaging 0.99
R6061:Rfx2 UTSW 17 56777473 missense possibly damaging 0.86
R6466:Rfx2 UTSW 17 56784397 missense probably benign 0.13
R6800:Rfx2 UTSW 17 56780804 missense probably damaging 0.99
R7329:Rfx2 UTSW 17 56803681 missense probably benign 0.05
R7476:Rfx2 UTSW 17 56803527 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACAGGGCCCAATCCTAAAGG -3'
(R):5'- AAATGGTGATGCTTTCTCTCCC -3'

Sequencing Primer
(F):5'- GGCCCAATCCTAAAGGCCTTTG -3'
(R):5'- AGACCCTCAGCTTTACGCC -3'
Posted On2015-01-23