Incidental Mutation 'R3409:Atp13a4'
ID 258437
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 4631413J11Rik, 9330174J19Rik
MMRRC Submission 040627-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3409 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 29214671-29363682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29232567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 923 (T923K)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057018
AA Change: T923K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: T923K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182357
Predicted Effect silent
Transcript: ENSMUST00000182573
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: T942K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: T942K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.2074 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,159,272 (GRCm39) V326A probably damaging Het
AI429214 C T 8: 37,461,071 (GRCm39) S73L probably benign Het
Ccdc150 A G 1: 54,395,932 (GRCm39) D805G probably benign Het
Ccdc185 T G 1: 182,576,313 (GRCm39) Q125H possibly damaging Het
Ccdc88a T A 11: 29,436,006 (GRCm39) C10S probably damaging Het
Cpsf1 G T 15: 76,485,981 (GRCm39) Y396* probably null Het
Dnpep A G 1: 75,293,270 (GRCm39) V33A probably damaging Het
Fbn1 G A 2: 125,254,585 (GRCm39) A226V possibly damaging Het
Frmd4a A T 2: 4,157,839 (GRCm39) probably benign Het
Gipr A G 7: 18,893,719 (GRCm39) V318A possibly damaging Het
Gsdmc4 A G 15: 63,763,895 (GRCm39) S401P probably benign Het
H2-M10.6 T A 17: 37,124,893 (GRCm39) V270E probably damaging Het
Klhl7 G T 5: 24,343,319 (GRCm39) V212L probably damaging Het
Krt10 C A 11: 99,278,087 (GRCm39) R322L probably damaging Het
Lrrn4 A G 2: 132,721,781 (GRCm39) L12P unknown Het
Mast2 C G 4: 116,168,107 (GRCm39) E881Q possibly damaging Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Notch3 C T 17: 32,369,676 (GRCm39) V772M possibly damaging Het
Nrxn1 G A 17: 90,515,795 (GRCm39) T19M probably damaging Het
Nudcd1 T C 15: 44,284,207 (GRCm39) M60V probably benign Het
Or10g1 T A 14: 52,647,818 (GRCm39) R170S possibly damaging Het
Or4c1 A G 2: 89,133,717 (GRCm39) F73S probably benign Het
Or4c115 T C 2: 88,927,668 (GRCm39) N201S possibly damaging Het
Or5b101 G C 19: 13,005,411 (GRCm39) A94G probably benign Het
Or5w8 T A 2: 87,688,005 (GRCm39) L162* probably null Het
Or8c9 T A 9: 38,241,640 (GRCm39) S252R possibly damaging Het
Pcdhb6 A G 18: 37,468,945 (GRCm39) E622G probably damaging Het
Pitrm1 G A 13: 6,628,517 (GRCm39) A937T possibly damaging Het
Plxnb1 G A 9: 108,935,681 (GRCm39) probably null Het
Ripk3 T G 14: 56,025,698 (GRCm39) N54T probably damaging Het
Rpn2 C A 2: 157,132,572 (GRCm39) A108E possibly damaging Het
Scaf11 A G 15: 96,312,745 (GRCm39) V1432A probably damaging Het
Sec14l5 C T 16: 4,983,518 (GRCm39) probably null Het
Serpina3n A G 12: 104,377,536 (GRCm39) E263G possibly damaging Het
Six4 A G 12: 73,159,657 (GRCm39) F101S probably damaging Het
Slc12a1 A G 2: 124,996,071 (GRCm39) T75A probably benign Het
Slc26a9 T C 1: 131,691,682 (GRCm39) S642P probably benign Het
Smu1 T C 4: 40,752,008 (GRCm39) T183A probably benign Het
Sptb T G 12: 76,657,589 (GRCm39) K1311Q possibly damaging Het
Tal2 A G 4: 53,785,843 (GRCm39) N8S probably damaging Het
Tenm4 A G 7: 96,544,367 (GRCm39) T2128A probably damaging Het
Tmem67 A T 4: 12,073,952 (GRCm39) M288K probably benign Het
Ubr1 A C 2: 120,793,929 (GRCm39) I85S probably benign Het
Vmn2r90 G T 17: 17,953,638 (GRCm39) V601L probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29,222,596 (GRCm39) splice site probably benign
IGL01577:Atp13a4 APN 16 29,260,102 (GRCm39) missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29,234,595 (GRCm39) splice site probably benign
IGL02165:Atp13a4 APN 16 29,252,828 (GRCm39) missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29,275,447 (GRCm39) missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29,258,920 (GRCm39) missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29,241,521 (GRCm39) missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29,260,125 (GRCm39) missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29,275,489 (GRCm39) missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29,274,306 (GRCm39) missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29,274,213 (GRCm39) missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29,240,542 (GRCm39) missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29,273,652 (GRCm39) missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29,290,771 (GRCm39) missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29,239,246 (GRCm39) missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29,228,528 (GRCm39) missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29,227,746 (GRCm39) missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29,275,429 (GRCm39) missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29,298,672 (GRCm39) missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29,241,502 (GRCm39) missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29,260,102 (GRCm39) missense possibly damaging 0.77
R3410:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29,237,389 (GRCm39) missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29,360,068 (GRCm39) missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29,271,421 (GRCm39) missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29,239,653 (GRCm39) intron probably benign
R4795:Atp13a4 UTSW 16 29,308,826 (GRCm39) critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29,227,779 (GRCm39) nonsense probably null
R4996:Atp13a4 UTSW 16 29,290,822 (GRCm39) missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29,228,686 (GRCm39) missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29,275,428 (GRCm39) missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29,275,422 (GRCm39) missense possibly damaging 0.94
R5395:Atp13a4 UTSW 16 29,239,706 (GRCm39) nonsense probably null
R5640:Atp13a4 UTSW 16 29,234,649 (GRCm39) missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29,275,389 (GRCm39) missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29,252,822 (GRCm39) missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29,290,719 (GRCm39) nonsense probably null
R6497:Atp13a4 UTSW 16 29,298,719 (GRCm39) missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29,298,659 (GRCm39) missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29,288,098 (GRCm39) missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29,239,723 (GRCm39) missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29,260,014 (GRCm39) missense
R7493:Atp13a4 UTSW 16 29,290,774 (GRCm39) missense
R7712:Atp13a4 UTSW 16 29,278,305 (GRCm39) missense
R7739:Atp13a4 UTSW 16 29,275,419 (GRCm39) missense
R7897:Atp13a4 UTSW 16 29,215,284 (GRCm39) missense
R7950:Atp13a4 UTSW 16 29,268,735 (GRCm39) missense
R8217:Atp13a4 UTSW 16 29,222,619 (GRCm39) missense
R8227:Atp13a4 UTSW 16 29,222,663 (GRCm39) missense
R8273:Atp13a4 UTSW 16 29,290,720 (GRCm39) missense
R8488:Atp13a4 UTSW 16 29,236,654 (GRCm39) missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29,273,587 (GRCm39) nonsense probably null
R8773:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R8921:Atp13a4 UTSW 16 29,273,592 (GRCm39) missense
R8940:Atp13a4 UTSW 16 29,273,508 (GRCm39) critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29,290,706 (GRCm39) critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29,268,797 (GRCm39) missense
R9292:Atp13a4 UTSW 16 29,241,500 (GRCm39) missense
R9415:Atp13a4 UTSW 16 29,227,821 (GRCm39) missense
R9453:Atp13a4 UTSW 16 29,239,659 (GRCm39) missense unknown
R9497:Atp13a4 UTSW 16 29,288,130 (GRCm39) critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29,241,544 (GRCm39) missense
R9614:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R9622:Atp13a4 UTSW 16 29,239,277 (GRCm39) missense
R9727:Atp13a4 UTSW 16 29,228,589 (GRCm39) missense
Z1176:Atp13a4 UTSW 16 29,241,405 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- GCTATACTTCAGGGGAAAGGC -3'
(R):5'- CCGAACCGTGGTGTGTTTTC -3'

Sequencing Primer
(F):5'- CTATACTTCAGGGGAAAGGCAAAAAG -3'
(R):5'- AACCGTGGTGTGTTTTCAGTAAGC -3'
Posted On 2015-01-23