Incidental Mutation 'R3410:Gpat2'
ID258447
Institutional Source Beutler Lab
Gene Symbol Gpat2
Ensembl Gene ENSMUSG00000046338
Gene Nameglycerol-3-phosphate acyltransferase 2, mitochondrial
SynonymsGpat2, A530057A03Rik
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127425199-127436092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127428291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 75 (V75M)
Ref Sequence ENSEMBL: ENSMUSP00000049619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062211]
Predicted Effect probably damaging
Transcript: ENSMUST00000062211
AA Change: V75M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: V75M

DomainStartEndE-ValueType
PlsC 199 333 1.45e-11 SMART
Blast:PlsC 347 387 7e-13 BLAST
low complexity region 431 468 N/A INTRINSIC
low complexity region 515 528 N/A INTRINSIC
low complexity region 593 613 N/A INTRINSIC
low complexity region 664 675 N/A INTRINSIC
Meta Mutation Damage Score 0.5699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Gpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Gpat2 APN 2 127432396 missense probably benign 0.01
IGL00479:Gpat2 APN 2 127434461 missense probably damaging 0.99
IGL01393:Gpat2 APN 2 127432651 missense probably damaging 1.00
IGL01759:Gpat2 APN 2 127430896 missense possibly damaging 0.94
IGL01764:Gpat2 APN 2 127427536 missense probably benign 0.18
IGL02631:Gpat2 APN 2 127434232 splice site probably benign
IGL02657:Gpat2 APN 2 127427331 missense probably benign 0.04
IGL02813:Gpat2 APN 2 127434455 missense possibly damaging 0.90
IGL02873:Gpat2 APN 2 127431755 missense probably benign 0.00
IGL02993:Gpat2 APN 2 127427566 missense probably damaging 1.00
R6669_gpat2_048 UTSW 2 127431918 missense possibly damaging 0.90
PIT4494001:Gpat2 UTSW 2 127433880 missense probably benign 0.00
R0078:Gpat2 UTSW 2 127428249 missense probably damaging 1.00
R0230:Gpat2 UTSW 2 127435845 missense possibly damaging 0.95
R1619:Gpat2 UTSW 2 127428717 missense probably benign 0.00
R1851:Gpat2 UTSW 2 127434819 missense possibly damaging 0.77
R1939:Gpat2 UTSW 2 127435959 makesense probably null
R2143:Gpat2 UTSW 2 127433762 missense probably damaging 1.00
R2165:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R2518:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3411:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3898:Gpat2 UTSW 2 127435098 missense probably damaging 1.00
R4080:Gpat2 UTSW 2 127433622 missense probably damaging 0.99
R4725:Gpat2 UTSW 2 127431982 missense possibly damaging 0.83
R4841:Gpat2 UTSW 2 127433967 missense probably benign 0.10
R5354:Gpat2 UTSW 2 127428723 missense probably damaging 1.00
R5941:Gpat2 UTSW 2 127428275 missense possibly damaging 0.53
R6362:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6374:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6375:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6377:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6380:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6381:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6382:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6383:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6384:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6393:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6565:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6594:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6595:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6649:Gpat2 UTSW 2 127432435 missense possibly damaging 0.81
R6665:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6666:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6667:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6668:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6669:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R7031:Gpat2 UTSW 2 127435475 missense probably damaging 0.99
R7096:Gpat2 UTSW 2 127428289 missense probably benign 0.02
R7307:Gpat2 UTSW 2 127434890 missense probably damaging 1.00
R7313:Gpat2 UTSW 2 127428295 missense probably damaging 0.99
R7365:Gpat2 UTSW 2 127426981 intron probably null
Predicted Primers PCR Primer
(F):5'- AGACAGCTCATGGGAAATGTACTC -3'
(R):5'- TATAGGCCTTAGTCCCACCC -3'

Sequencing Primer
(F):5'- GCTCATGGGAAATGTACTCTATACC -3'
(R):5'- AGTGGCTCTACACCTTACAGG -3'
Posted On2015-01-23