Incidental Mutation 'R3410:Ovol2'
ID258448
Institutional Source Beutler Lab
Gene Symbol Ovol2
Ensembl Gene ENSMUSG00000037279
Gene Nameovo like zinc finger 2
SynonymsM-OVO, movo2, M-OVO-A, M-OVO-B, Ovol2, Zfp339
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144305175-144332146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144317876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000099460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037423] [ENSMUST00000103171]
Predicted Effect probably benign
Transcript: ENSMUST00000037423
AA Change: S115P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044026
Gene: ENSMUSG00000037279
AA Change: S115P

DomainStartEndE-ValueType
low complexity region 46 74 N/A INTRINSIC
ZnF_C2H2 118 140 3.34e-2 SMART
ZnF_C2H2 146 168 2.09e-3 SMART
ZnF_C2H2 174 197 2.27e-4 SMART
ZnF_C2H2 213 236 6.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103171
AA Change: S82P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099460
Gene: ENSMUSG00000037279
AA Change: S82P

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
ZnF_C2H2 85 107 3.34e-2 SMART
ZnF_C2H2 113 135 2.09e-3 SMART
ZnF_C2H2 141 164 2.27e-4 SMART
ZnF_C2H2 180 203 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138582
Meta Mutation Damage Score 0.1214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the evolutionarily conserved ovo-like protein family. Mammalian members of this family contain a single zinc finger domain composed of a tetrad of C2H2 zinc fingers with variable N- and C-terminal extensions that contain intrinsically disordered domains. Members of this family are involved in epithelial development and differentiation. Knockout of this gene in mouse results in early embryonic lethality with phenotypes that include neurectoderm expansion, impaired vascularization, and heart anomalies. In humans, allelic variants of this gene have been associated with posterior polymorphous corneal dystrophy. [provided by RefSeq, Apr 2016]
PHENOTYPE: Embryos homozygous for a null allele are small and die at E9.5-E10.5 with an open neural tube, impaired extraembryonic and embryonic vascularization, abnormal cardiogenesis and placental defects. Homozygotes for another null allele die by E10.5 with brain, neural crest, gut tube and heart anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Ovol2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ovol2 APN 2 144305679 missense probably damaging 1.00
IGL02166:Ovol2 APN 2 144305730 missense possibly damaging 0.95
boh UTSW 2 144317860 missense probably damaging 1.00
R0084:Ovol2 UTSW 2 144305888 missense probably damaging 0.98
R0760:Ovol2 UTSW 2 144331759 critical splice donor site probably null
R0883:Ovol2 UTSW 2 144331790 missense probably damaging 0.99
R1672:Ovol2 UTSW 2 144305790 missense probably damaging 1.00
R4780:Ovol2 UTSW 2 144331283 intron probably benign
R5127:Ovol2 UTSW 2 144317860 missense probably damaging 1.00
R7432:Ovol2 UTSW 2 144317872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACCAGTGTGCGTGCGTAC -3'
(R):5'- TGCTGTAAGTCTGTGCAGAGAC -3'

Sequencing Primer
(F):5'- GTACGTGCCTCTTCAGGTCG -3'
(R):5'- GCAGAAACATTTCTCTGTACCAGTC -3'
Posted On2015-01-23