Incidental Mutation 'R3410:Olfr494'
ID258464
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108368344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 285 (I285F)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073059
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: I285F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209743
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210291
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATCACAGTGTTTGTCATAGC -3'
(R):5'- AGTCTTATAACTTGAGATGGTGGTC -3'

Sequencing Primer
(F):5'- ACAGTGTTTGTCATAGCTGTCTC -3'
(R):5'- ATAACTTGAGATGGTGGTCATATTGG -3'
Posted On2015-01-23