Incidental Mutation 'R3410:Sltm'
ID258469
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70585958 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 728 (L728V)
Ref Sequence ENSEMBL: ENSMUSP00000149059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049263
AA Change: L746V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: L746V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216816
AA Change: L728V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216881
Predicted Effect probably benign
Transcript: ENSMUST00000217593
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AACAGCTAGTTCTGTCCCTGC -3'
(R):5'- CAGTGTGGACTTAGCACTTCAC -3'

Sequencing Primer
(F):5'- TGCTACTCACTGTTGTATCTTGAG -3'
(R):5'- GTGGACTTAGCACTTCACTAAGATC -3'
Posted On2015-01-23