Mutagenetix > Incidental Mutation

Incidental Mutation 'R3410:Adamts16'

258487

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

040628-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3410 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70901345 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 911 (T911A)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably benign
Transcript: ENSMUST00000080145
AA Change: T911A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: T911A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Meta Mutation Damage Score

0.0678

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	T	C	8: 120,342,708 (GRCm39)	V418A	probably benign	Het
Adgra1	T	C	7: 139,427,619 (GRCm39)	F62S	possibly damaging	Het
Adgra3	A	G	5: 50,159,272 (GRCm39)	V326A	probably damaging	Het
Adgrg6	A	G	10: 14,316,114 (GRCm39)	F569S	probably benign	Het
Alcam	T	C	16: 52,130,261 (GRCm39)	T30A	probably null	Het
Arnt2	G	A	7: 83,924,655 (GRCm39)	R391W	probably damaging	Het
Ascc3	T	C	10: 50,576,196 (GRCm39)	V817A	probably damaging	Het
Atp13a4	G	T	16: 29,232,567 (GRCm39)	T923K	probably damaging	Het
Atp5po	C	T	16: 91,725,794 (GRCm39)	R64H	probably damaging	Het
Ccdc185	T	G	1: 182,576,313 (GRCm39)	Q125H	possibly damaging	Het
Ccdc88a	T	A	11: 29,436,006 (GRCm39)	C10S	probably damaging	Het
Cct2	T	C	10: 116,897,968 (GRCm39)	N73S	probably benign	Het
Clock	G	A	5: 76,377,401 (GRCm39)	Q633*	probably null	Het
Col6a2	T	C	10: 76,439,193 (GRCm39)	I826V	probably benign	Het
Cpsf1	G	T	15: 76,485,981 (GRCm39)	Y396*	probably null	Het
Dnah1	A	T	14: 30,991,774 (GRCm39)	M3076K	possibly damaging	Het
Dxo	A	G	17: 35,057,825 (GRCm39)	N177D	probably damaging	Het
Fbxw28	A	T	9: 109,167,472 (GRCm39)	V95E	possibly damaging	Het
Galnt6	T	C	15: 100,597,018 (GRCm39)	N383D	probably damaging	Het
Gpat2	G	A	2: 127,270,211 (GRCm39)	V75M	probably damaging	Het
Grik5	T	C	7: 24,762,397 (GRCm39)	D198G	probably benign	Het
Gsdmc4	A	G	15: 63,763,895 (GRCm39)	S401P	probably benign	Het
Gspt1	A	T	16: 11,047,109 (GRCm39)	D435E	probably damaging	Het
Hsf2	T	C	10: 57,381,378 (GRCm39)	S266P	probably damaging	Het
Jade2	T	C	11: 51,708,050 (GRCm39)	D721G	probably benign	Het
Klhl7	G	T	5: 24,343,319 (GRCm39)	V212L	probably damaging	Het
Klra17	T	A	6: 129,851,809 (GRCm39)	N21I	probably damaging	Het
L3mbtl3	T	C	10: 26,215,197 (GRCm39)	N196S	unknown	Het
Lama3	G	C	18: 12,546,915 (GRCm39)		probably null	Het
Mcm5	T	C	8: 75,848,272 (GRCm39)	M507T	possibly damaging	Het
Mycbp2	T	C	14: 103,372,553 (GRCm39)	R814G	probably damaging	Het
Nlrp4b	A	G	7: 10,449,456 (GRCm39)	E186G	probably damaging	Het
Nlrp4c	A	G	7: 6,095,569 (GRCm39)	K816E	possibly damaging	Het
Nod1	G	T	6: 54,921,902 (GRCm39)	R139S	probably benign	Het
Nudcd1	T	C	15: 44,284,207 (GRCm39)	M60V	probably benign	Het
Or5b101	G	C	19: 13,005,411 (GRCm39)	A94G	probably benign	Het
Or5p63	G	A	7: 107,811,490 (GRCm39)	P82L	possibly damaging	Het
Or5p69	A	T	7: 107,967,551 (GRCm39)	I285F	possibly damaging	Het
Or8g28	G	T	9: 39,169,897 (GRCm39)	Q24K	possibly damaging	Het
Ovol2	A	G	2: 144,159,796 (GRCm39)	S82P	probably benign	Het
Ppl	T	C	16: 4,925,381 (GRCm39)	E86G	possibly damaging	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Ripk4	T	C	16: 97,545,157 (GRCm39)	T497A	probably benign	Het
Scml4	A	G	10: 42,833,667 (GRCm39)	Y327C	probably damaging	Het
Serpina3n	A	G	12: 104,377,536 (GRCm39)	E263G	possibly damaging	Het
Six4	A	G	12: 73,159,657 (GRCm39)	F101S	probably damaging	Het
Sltm	T	G	9: 70,493,240 (GRCm39)	L728V	probably damaging	Het
Sptb	T	G	12: 76,657,589 (GRCm39)	K1311Q	possibly damaging	Het
Sycp1	T	C	3: 102,748,357 (GRCm39)	K812E	possibly damaging	Het
Tenm4	T	C	7: 96,501,737 (GRCm39)	Y1314H	probably damaging	Het
Tmem67	A	T	4: 12,073,952 (GRCm39)	M288K	probably benign	Het
Toporsl	T	C	4: 52,610,970 (GRCm39)	S288P	probably benign	Het
Ttn	A	C	2: 76,772,749 (GRCm39)	N2415K	possibly damaging	Het
Vmn2r65	T	C	7: 84,595,896 (GRCm39)	I263V	probably benign	Het
Vmn2r89	A	T	14: 51,693,628 (GRCm39)	E326V	probably damaging	Het
Wdr81	A	G	11: 75,343,758 (GRCm39)	I503T	probably damaging	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70,927,671 (GRCm39)	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70,916,111 (GRCm39)	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70,901,315 (GRCm39)	nonsense	probably null
R5464:Adamts16	UTSW	13	70,909,868 (GRCm39)	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70,878,234 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAAGACATTTGTCCTGGTCC -3'
(R):5'- TGTGACACGATAGCTCACAC -3'

Sequencing Primer
(F):5'- GGTCCTCCATTCAGGTTGC -3'
(R):5'- GATAGCTCACACAACCCTTTCTC -3'

Posted On

2015-01-23