Incidental Mutation 'R3410:Gspt1'
ID258497
Institutional Source Beutler Lab
Gene Symbol Gspt1
Ensembl Gene ENSMUSG00000062203
Gene NameG1 to S phase transition 1
SynonymsGst-1, G1st, Gst-1
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11219292-11254325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11229245 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 435 (D435E)
Ref Sequence ENSEMBL: ENSMUSP00000130583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080030] [ENSMUST00000167571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080030
AA Change: D436E

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078940
Gene: ENSMUSG00000062203
AA Change: D436E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 4.3e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 151 193 N/A INTRINSIC
Pfam:GTP_EFTU 209 482 3.1e-47 PFAM
Pfam:GTP_EFTU_D2 451 518 1.2e-8 PFAM
Pfam:GTP_EFTU_D3 524 632 7.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166063
Predicted Effect probably benign
Transcript: ENSMUST00000167025
SMART Domains Protein: ENSMUSP00000130959
Gene: ENSMUSG00000062203

DomainStartEndE-ValueType
Pfam:GTP_EFTU_D3 18 96 2.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167571
AA Change: D435E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130583
Gene: ENSMUSG00000062203
AA Change: D435E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 7.1e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Pfam:GTP_EFTU 208 476 4.3e-49 PFAM
Pfam:GTP_EFTU_D2 450 517 1.3e-7 PFAM
Pfam:GTP_EFTU_D3 523 631 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Meta Mutation Damage Score 0.1043 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Gspt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Gspt1 APN 16 11222612 missense probably damaging 0.99
IGL00902:Gspt1 APN 16 11232579 missense probably damaging 1.00
IGL00983:Gspt1 APN 16 11230997 splice site probably benign
IGL01775:Gspt1 APN 16 11223295 missense possibly damaging 0.92
IGL02079:Gspt1 APN 16 11240829 missense probably benign 0.17
IGL02122:Gspt1 APN 16 11229216 missense probably damaging 1.00
IGL02525:Gspt1 APN 16 11230990 missense probably damaging 1.00
IGL03092:Gspt1 APN 16 11238899 missense probably benign 0.11
goliad UTSW 16 11224542 missense probably benign 0.04
R0835:Gspt1 UTSW 16 11238938 missense probably benign
R1519:Gspt1 UTSW 16 11220855 missense probably damaging 1.00
R4834:Gspt1 UTSW 16 11222717 missense probably damaging 1.00
R4866:Gspt1 UTSW 16 11222665 missense possibly damaging 0.69
R5121:Gspt1 UTSW 16 11223301 missense probably damaging 0.99
R5408:Gspt1 UTSW 16 11253855 missense probably benign
R5410:Gspt1 UTSW 16 11230510 missense probably benign 0.00
R5517:Gspt1 UTSW 16 11253979 missense unknown
R5704:Gspt1 UTSW 16 11228193 missense possibly damaging 0.89
R6224:Gspt1 UTSW 16 11224542 missense probably benign 0.04
R6317:Gspt1 UTSW 16 11223208 splice site probably null
R7069:Gspt1 UTSW 16 11222661 missense probably damaging 1.00
R7151:Gspt1 UTSW 16 11253828 missense probably benign 0.05
R7317:Gspt1 UTSW 16 11222657 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCTTCCATAAGCAAACATTC -3'
(R):5'- CTAGGGACCTTCTTTTAAGAGTAAGG -3'

Sequencing Primer
(F):5'- GCCTTCCATAAGCAAACATTCAAAAG -3'
(R):5'- TCTAAGGTGTAAGTTTCATGAAAAGG -3'
Posted On2015-01-23