Incidental Mutation 'R3410:Alcam'
ID258499
Institutional Source Beutler Lab
Gene Symbol Alcam
Ensembl Gene ENSMUSG00000022636
Gene Nameactivated leukocyte cell adhesion molecule
SynonymsSC1, BEN, MuSC, DM-GRASP, CD166
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location52248996-52454074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52309898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000129714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023312] [ENSMUST00000164728] [ENSMUST00000168071] [ENSMUST00000170035]
Predicted Effect probably null
Transcript: ENSMUST00000023312
AA Change: T30A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023312
Gene: ENSMUSG00000022636
AA Change: T30A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 5.1e-24 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 489 3.8e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164728
AA Change: T30A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127141
Gene: ENSMUSG00000022636
AA Change: T30A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 1e-22 PFAM
Pfam:Ig_2 147 235 3.8e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 496 1.9e-7 PFAM
Pfam:Ig_2 415 502 1.5e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168071
AA Change: T30A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131001
Gene: ENSMUSG00000022636
AA Change: T30A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170035
AA Change: T30A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129714
Gene: ENSMUSG00000022636
AA Change: T30A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 3.4e-23 PFAM
Pfam:Ig_2 147 235 1.3e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 491 5.9e-8 PFAM
Pfam:Ig_2 415 502 4.9e-7 PFAM
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Meta Mutation Damage Score 0.3367 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display abnormal motor neuron and retinal ganglion cell morphology and retinal dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Alcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Alcam APN 16 52295017 splice site probably benign
IGL00737:Alcam APN 16 52253180 missense unknown
IGL01514:Alcam APN 16 52274290 splice site probably benign
IGL01837:Alcam APN 16 52253168 missense probably benign 0.10
IGL02143:Alcam APN 16 52305619 missense probably damaging 0.99
IGL02231:Alcam APN 16 52274050 splice site probably benign
IGL02375:Alcam APN 16 52288936 missense probably benign 0.00
IGL02579:Alcam APN 16 52270772 missense probably damaging 1.00
IGL02678:Alcam APN 16 52274038 missense probably damaging 1.00
IGL02798:Alcam APN 16 52305639 missense probably damaging 1.00
IGL02974:Alcam APN 16 52295716 missense probably benign 0.05
IGL03335:Alcam APN 16 52291003 nonsense probably null
PIT4402001:Alcam UTSW 16 52295134 missense probably damaging 1.00
PIT4651001:Alcam UTSW 16 52295187 missense probably benign
R0282:Alcam UTSW 16 52295741 missense probably damaging 0.99
R0395:Alcam UTSW 16 52309864 missense probably benign 0.42
R0760:Alcam UTSW 16 52295672 missense probably benign 0.32
R0882:Alcam UTSW 16 52253210 missense possibly damaging 0.47
R1433:Alcam UTSW 16 52295752 critical splice acceptor site probably null
R1677:Alcam UTSW 16 52270773 missense probably damaging 1.00
R1751:Alcam UTSW 16 52270714 missense probably damaging 1.00
R1767:Alcam UTSW 16 52270714 missense probably damaging 1.00
R2440:Alcam UTSW 16 52305613 missense probably damaging 1.00
R2963:Alcam UTSW 16 52295041 missense probably benign 0.00
R4327:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4328:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4888:Alcam UTSW 16 52268813 missense probably benign 0.03
R5088:Alcam UTSW 16 52288927 missense probably damaging 1.00
R5202:Alcam UTSW 16 52274236 missense probably damaging 1.00
R5208:Alcam UTSW 16 52295048 nonsense probably null
R5278:Alcam UTSW 16 52274275 missense probably benign
R5799:Alcam UTSW 16 52309849 missense probably benign 0.28
R5909:Alcam UTSW 16 52290993 missense probably benign
R5960:Alcam UTSW 16 52295126 missense probably benign 0.30
R6194:Alcam UTSW 16 52268398 missense probably damaging 1.00
R6434:Alcam UTSW 16 52288827 intron probably null
R6831:Alcam UTSW 16 52309901 missense probably benign 0.00
R6868:Alcam UTSW 16 52268385 missense probably damaging 1.00
R6930:Alcam UTSW 16 52305655 missense probably benign 0.14
R6957:Alcam UTSW 16 52276894 missense probably damaging 1.00
R7109:Alcam UTSW 16 52276829 missense probably damaging 0.98
R7473:Alcam UTSW 16 52452519 unclassified probably benign
R7562:Alcam UTSW 16 52268823 missense probably benign 0.00
R7568:Alcam UTSW 16 52268386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTTCAGACAAAGCAGATCCTTC -3'
(R):5'- GCTACTTGAATACTAGCATTTCTCC -3'

Sequencing Primer
(F):5'- TGTCAGTGTTACATACTCTCAGAG -3'
(R):5'- AGAGGTAAATTTGATAATCCGTTCC -3'
Posted On2015-01-23