Incidental Mutation 'R3410:Atp5o'
ID258500
Institutional Source Beutler Lab
Gene Symbol Atp5o
Ensembl Gene ENSMUSG00000022956
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
SynonymsD12Wsu28e
MMRRC Submission 040628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3410 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91925214-91931687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91928906 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 64 (R64H)
Ref Sequence ENSEMBL: ENSMUSP00000023677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023677] [ENSMUST00000139277] [ENSMUST00000154661] [ENSMUST00000155452] [ENSMUST00000159295]
Predicted Effect probably damaging
Transcript: ENSMUST00000023677
AA Change: R64H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023677
Gene: ENSMUSG00000022956
AA Change: R64H

DomainStartEndE-ValueType
Pfam:OSCP 37 209 2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132049
Predicted Effect probably benign
Transcript: ENSMUST00000139277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150642
Predicted Effect probably damaging
Transcript: ENSMUST00000154661
AA Change: R66H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000155452
AA Change: R61H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118216
Gene: ENSMUSG00000022956
AA Change: R61H

DomainStartEndE-ValueType
Pfam:OSCP 34 67 1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the F-type ATPase found in the mitochondrial matrix. F-type ATPases are composed of a catalytic core and a membrane proton channel. The encoded protein appears to be part of the connector linking these two components and may be involved in transmission of conformational changes or proton conductance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,969 V418A probably benign Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Adgrg6 A G 10: 14,440,370 F569S probably benign Het
Alcam T C 16: 52,309,898 T30A probably null Het
Arnt2 G A 7: 84,275,447 R391W probably damaging Het
Ascc3 T C 10: 50,700,100 V817A probably damaging Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cct2 T C 10: 117,062,063 N73S probably benign Het
Clock G A 5: 76,229,554 Q633* probably null Het
Col6a2 T C 10: 76,603,359 I826V probably benign Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dxo A G 17: 34,838,849 N177D probably damaging Het
Fbxw28 A T 9: 109,338,404 V95E possibly damaging Het
Galnt6 T C 15: 100,699,137 N383D probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
Gspt1 A T 16: 11,229,245 D435E probably damaging Het
Hsf2 T C 10: 57,505,282 S266P probably damaging Het
Jade2 T C 11: 51,817,223 D721G probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
L3mbtl3 T C 10: 26,339,299 N196S unknown Het
Lama3 G C 18: 12,413,858 probably null Het
Mcm5 T C 8: 75,121,644 M507T possibly damaging Het
Mycbp2 T C 14: 103,135,117 R814G probably damaging Het
Nlrp4b A G 7: 10,715,529 E186G probably damaging Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr487 G A 7: 108,212,283 P82L possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Ovol2 A G 2: 144,317,876 S82P probably benign Het
Ppl T C 16: 5,107,517 E86G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Scml4 A G 10: 42,957,671 Y327C probably damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Sltm T G 9: 70,585,958 L728V probably damaging Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Sycp1 T C 3: 102,841,041 K812E possibly damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Toporsl T C 4: 52,610,970 S288P probably benign Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Vmn2r89 A T 14: 51,456,171 E326V probably damaging Het
Wdr81 A G 11: 75,452,932 I503T probably damaging Het
Other mutations in Atp5o
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Atp5o APN 16 91930401 missense probably damaging 1.00
IGL02547:Atp5o APN 16 91928961 missense probably damaging 1.00
IGL02626:Atp5o APN 16 91686313 missense probably damaging 1.00
IGL02632:Atp5o APN 16 91928942 missense probably benign 0.15
R0644:Atp5o UTSW 16 91926484 missense probably damaging 0.99
R3411:Atp5o UTSW 16 91928906 missense probably damaging 1.00
R5543:Atp5o UTSW 16 91926530 missense probably benign 0.00
R5550:Atp5o UTSW 16 91930404 missense probably damaging 0.99
R7257:Atp5o UTSW 16 91926867 missense probably damaging 1.00
R7781:Atp5o UTSW 16 91926529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGGTTCATGTGAATATACTTACGCATC -3'
(R):5'- TAGGACTGCACCTTGGCTTG -3'

Sequencing Primer
(F):5'- GTGAATATACTTACGCATCTCCTAGC -3'
(R):5'- CACCTTGGCTTGGCAGTG -3'
Posted On2015-01-23