Incidental Mutation 'R3701:Zbed5'
ID258513
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Namezinc finger, BED type containing 5
Synonyms2410018M08Rik
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129895723-129903623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129903159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 650 (D650N)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041466
AA Change: D650N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: D650N

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129902133 unclassified probably null
IGL03334:Zbed5 APN 5 129902355 missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129901726 missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129902272 missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129902179 missense probably benign 0.00
R1967:Zbed5 UTSW 5 129901669 missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129902751 missense probably benign 0.01
R2925:Zbed5 UTSW 5 129903198 missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129902146 missense possibly damaging 0.66
R3702:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3916:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R3917:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R4547:Zbed5 UTSW 5 129902851 nonsense probably null
R4548:Zbed5 UTSW 5 129902851 nonsense probably null
R5195:Zbed5 UTSW 5 129902178 missense probably benign 0.01
R5500:Zbed5 UTSW 5 129901982 nonsense probably null
R5813:Zbed5 UTSW 5 129902218 missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129903369 missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129903289 missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129903185 missense probably benign
R6931:Zbed5 UTSW 5 129903329 nonsense probably null
R7223:Zbed5 UTSW 5 129900438 missense probably damaging 1.00
R7831:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
R7914:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CGCCTTCTTTGAGGAACATG -3'
(R):5'- ACTACACTGCTACATTTCGGG -3'

Sequencing Primer
(F):5'- CGCCTTCTTTGAGGAACATGACATTG -3'
(R):5'- TTCTCACCAGATCAGAAATTCTCGGG -3'
Posted On2015-01-23