Incidental Mutation 'R3701:Kcnj5'
ID258521
Institutional Source Beutler Lab
Gene Symbol Kcnj5
Ensembl Gene ENSMUSG00000032034
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 5
SynonymsGIRK4, Kir3.4
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32314707-32344350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32317828 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000149461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]
Predicted Effect probably benign
Transcript: ENSMUST00000034533
AA Change: T338A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: T338A

DomainStartEndE-ValueType
Pfam:IRK 54 377 7e-147 PFAM
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214223
AA Change: T338A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216033
AA Change: T25A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Kcnj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Kcnj5 APN 9 32322423 missense probably damaging 1.00
IGL01700:Kcnj5 APN 9 32322629 missense probably damaging 1.00
IGL02250:Kcnj5 APN 9 32317756 missense probably damaging 1.00
IGL02683:Kcnj5 APN 9 32317780 missense possibly damaging 0.94
IGL02981:Kcnj5 APN 9 32322581 missense probably damaging 1.00
R0388:Kcnj5 UTSW 9 32317863 missense probably damaging 1.00
R0464:Kcnj5 UTSW 9 32322973 missense possibly damaging 0.87
R0524:Kcnj5 UTSW 9 32322974 missense probably benign 0.16
R1711:Kcnj5 UTSW 9 32322569 missense probably damaging 1.00
R1730:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R1783:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R2203:Kcnj5 UTSW 9 32322900 missense probably benign 0.43
R2424:Kcnj5 UTSW 9 32322820 missense probably damaging 1.00
R4459:Kcnj5 UTSW 9 32322395 missense probably damaging 1.00
R4657:Kcnj5 UTSW 9 32322677 missense probably benign
R5422:Kcnj5 UTSW 9 32317705 missense probably benign 0.00
R6073:Kcnj5 UTSW 9 32317800 missense probably damaging 1.00
R7185:Kcnj5 UTSW 9 32322176 missense probably damaging 1.00
R7289:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7294:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7295:Kcnj5 UTSW 9 32322791 missense probably damaging 1.00
R7296:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7450:Kcnj5 UTSW 9 32322195 missense possibly damaging 0.52
R7688:Kcnj5 UTSW 9 32322968 missense probably benign 0.00
R7911:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
Z1177:Kcnj5 UTSW 9 32317698 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCCCAGCCTCAGCACAG -3'
(R):5'- TGATGGATGGTGGAACAGGT -3'

Sequencing Primer
(F):5'- ACAGCCCCCAAGCAAGG -3'
(R):5'- AGGTGAATAGATGACTGGATGTATAG -3'
Posted On2015-01-23