Incidental Mutation 'R3701:Nmur2'
ID258527
Institutional Source Beutler Lab
Gene Symbol Nmur2
Ensembl Gene ENSMUSG00000037393
Gene Nameneuromedin U receptor 2
Synonyms
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location56024987-56041010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56040777 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 36 (L36P)
Ref Sequence ENSEMBL: ENSMUSP00000044718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037682]
Predicted Effect probably damaging
Transcript: ENSMUST00000037682
AA Change: L36P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: L36P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 337 4.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 48 334 1.8e-13 PFAM
Pfam:7tm_1 54 319 5.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134285
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Nmur2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nmur2 APN 11 56040777 missense probably damaging 0.99
IGL01591:Nmur2 APN 11 56026999 missense probably benign
IGL01960:Nmur2 APN 11 56040511 missense probably damaging 0.99
IGL02108:Nmur2 APN 11 56040364 missense probably benign 0.33
IGL02602:Nmur2 APN 11 56027063 missense probably benign 0.19
PIT4677001:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R0324:Nmur2 UTSW 11 56040520 missense probably damaging 1.00
R0458:Nmur2 UTSW 11 56040568 missense possibly damaging 0.93
R0718:Nmur2 UTSW 11 56029498 splice site probably benign
R1799:Nmur2 UTSW 11 56029621 missense probably damaging 1.00
R2099:Nmur2 UTSW 11 56040763 missense probably benign 0.00
R2263:Nmur2 UTSW 11 56029561 missense probably damaging 0.97
R3705:Nmur2 UTSW 11 56040474 missense probably damaging 1.00
R3951:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4083:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4744:Nmur2 UTSW 11 56040835 missense probably benign 0.01
R4747:Nmur2 UTSW 11 56040279 missense probably benign 0.05
R5288:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5384:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5579:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R6329:Nmur2 UTSW 11 56029585 missense probably benign 0.30
R6477:Nmur2 UTSW 11 56029591 missense probably damaging 1.00
R7445:Nmur2 UTSW 11 56032940 missense probably damaging 0.97
R7580:Nmur2 UTSW 11 56026982 missense probably benign 0.03
R7899:Nmur2 UTSW 11 56040335 missense probably benign
R7982:Nmur2 UTSW 11 56040335 missense probably benign
X0062:Nmur2 UTSW 11 56040849 missense probably benign 0.01
Z1176:Nmur2 UTSW 11 56027101 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTTGAAGTAGCATCCCACCG -3'
(R):5'- TCAGCTTGAGACAGAGCCTC -3'

Sequencing Primer
(F):5'- GGATAATTGTGCCACAACTCG -3'
(R):5'- TTGAGACAGAGCCTCAAGAGC -3'
Posted On2015-01-23