Incidental Mutation 'R3701:Fam189a2'
ID258546
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23979467 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 354 (E354G)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably benign
Transcript: ENSMUST00000096164
AA Change: E354G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: E354G

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGCCCTAAGAGTTTGAATACC -3'
(R):5'- TATGGAGCACGCATCAAGGG -3'

Sequencing Primer
(F):5'- AGAGTTTGAATACCTTACCTCCAGC -3'
(R):5'- CATCAAGGGTGTGGAAGTGTTC -3'
Posted On2015-01-23