Incidental Mutation 'R3702:Tcea1'
ID258551
Institutional Source Beutler Lab
Gene Symbol Tcea1
Ensembl Gene ENSMUSG00000033813
Gene Nametranscription elongation factor A (SII) 1
SynonymsS-II
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location4857814-4897909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4894935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 276 (V276A)
Ref Sequence ENSEMBL: ENSMUSP00000080266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081551] [ENSMUST00000165720]
Predicted Effect probably benign
Transcript: ENSMUST00000081551
AA Change: V276A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080266
Gene: ENSMUSG00000033813
AA Change: V276A

DomainStartEndE-ValueType
TFS2N 5 79 2.56e-31 SMART
low complexity region 83 93 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
TFS2M 138 239 1.32e-44 SMART
ZnF_C2C2 261 300 3.6e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165720
AA Change: V287A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129157
Gene: ENSMUSG00000033813
AA Change: V287A

DomainStartEndE-ValueType
Pfam:Med26 38 88 1.1e-18 PFAM
low complexity region 94 104 N/A INTRINSIC
low complexity region 111 126 N/A INTRINSIC
TFS2M 149 250 1.32e-44 SMART
ZnF_C2C2 272 311 3.6e-21 SMART
Meta Mutation Damage Score 0.1457 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired definitive erythropoiesis with loss of late stage erythroblasts, fetal liver hypoplasia, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Tcea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Tcea1 APN 1 4896347 splice site probably benign
IGL02361:Tcea1 APN 1 4896347 splice site probably benign
IGL02367:Tcea1 APN 1 4878133 critical splice donor site probably null
IGL02813:Tcea1 APN 1 4886756 missense probably benign 0.06
R0403:Tcea1 UTSW 1 4889503 missense probably benign
R0707:Tcea1 UTSW 1 4880346 intron probably benign
R1157:Tcea1 UTSW 1 4889447 splice site probably null
R4541:Tcea1 UTSW 1 4893436 missense probably damaging 1.00
R4764:Tcea1 UTSW 1 4894944 missense probably damaging 1.00
R5428:Tcea1 UTSW 1 4880345 intron probably benign
R6005:Tcea1 UTSW 1 4890773 missense probably benign 0.03
R6661:Tcea1 UTSW 1 4858429 intron probably benign
R6792:Tcea1 UTSW 1 4892045 missense probably benign 0.00
R7215:Tcea1 UTSW 1 4867483 missense probably damaging 0.98
R7557:Tcea1 UTSW 1 4894990 nonsense probably null
R7635:Tcea1 UTSW 1 4889551 missense probably benign 0.01
R8033:Tcea1 UTSW 1 4891918 missense probably damaging 0.98
Z1177:Tcea1 UTSW 1 4857977 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGGATAAATTACACATGAAGGAC -3'
(R):5'- GCATAAACTTGCTTGTATGAGACG -3'

Sequencing Primer
(F):5'- TTACACATGAAGGACAACAGAATAAG -3'
(R):5'- TGTTTACTGAAAAGCTACAAACCC -3'
Posted On2015-01-23