Mutagenetix > Incidental Mutations

Incidental Mutation 'R3702:Taf3'

258552

Institutional Source

Beutler Lab

Gene Symbol

Taf3

Ensembl Gene

ENSMUSG00000025782

Gene Name

TATA-box binding protein associated factor 3

Synonyms

mTAFII140, 4933439M23Rik

MMRRC Submission

040695-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R3702 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9914552-10048596 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 9952561 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 112 (T112I)

Ref Sequence

ENSEMBL: ENSMUSP00000110559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]

Predicted Effect

probably benign
Transcript: ENSMUST00000026888
AA Change: T265I

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: T265I

Domain	Start	End	E-Value	Type
BTP	3	79	1.94e-34	SMART
low complexity region	159	173	N/A	INTRINSIC
low complexity region	237	253	N/A	INTRINSIC
low complexity region	306	325	N/A	INTRINSIC
low complexity region	404	423	N/A	INTRINSIC
low complexity region	447	461	N/A	INTRINSIC
low complexity region	487	505	N/A	INTRINSIC
coiled coil region	519	572	N/A	INTRINSIC
coiled coil region	611	651	N/A	INTRINSIC
coiled coil region	692	751	N/A	INTRINSIC
low complexity region	779	790	N/A	INTRINSIC
low complexity region	795	821	N/A	INTRINSIC
low complexity region	826	837	N/A	INTRINSIC
PHD	869	915	4.77e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114909
AA Change: T112I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: T112I

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
low complexity region	84	100	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	251	270	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
low complexity region	334	352	N/A	INTRINSIC
coiled coil region	366	419	N/A	INTRINSIC
coiled coil region	458	498	N/A	INTRINSIC
coiled coil region	539	598	N/A	INTRINSIC
low complexity region	626	637	N/A	INTRINSIC
low complexity region	642	668	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
PHD	716	762	4.77e-11	SMART

Meta Mutation Damage Score

0.0972

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,015,330	N55I	probably benign	Het
9530053A07Rik	G	A	7: 28,157,778	V2184M	probably damaging	Het
Abca5	C	T	11: 110,288,058		probably null	Het
Cacna1a	T	G	8: 84,617,846	S1846A	probably damaging	Het
Cacna1i	A	T	15: 80,381,071		probably benign	Het
Calhm3	T	A	19: 47,151,748	D302V	possibly damaging	Het
Cluh	A	G	11: 74,665,356	M878V	probably benign	Het
Col24a1	C	T	3: 145,337,860	H603Y	probably benign	Het
Commd1	T	A	11: 22,974,057	L277H	probably damaging	Het
Cpped1	G	T	16: 11,828,440	D135E	probably damaging	Het
Cul5	T	C	9: 53,629,216	K499E	probably damaging	Het
Elfn1	A	G	5: 139,972,359	T373A	probably benign	Het
Fam83h	C	T	15: 76,002,650	R946K	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Grik4	T	C	9: 42,675,218	K114E	probably damaging	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Itgb1bp2	T	C	X: 101,451,687		probably benign	Het
Lrp1	C	A	10: 127,595,103	R359L	probably damaging	Het
Lyn	A	G	4: 3,742,455	H28R	probably benign	Het
Mtmr10	T	C	7: 64,337,899	L729P	probably damaging	Het
Myot	T	A	18: 44,354,095		probably null	Het
Obox2	G	T	7: 15,396,957	R38L	probably benign	Het
Olfr787	A	T	10: 129,462,952	Y92F	probably damaging	Het
Pcdha3	A	G	18: 36,947,348	Q381R	probably benign	Het
Pip4k2b	A	G	11: 97,729,548		probably benign	Het
Ppig	T	A	2: 69,733,209	S89T	probably damaging	Het
Prune2	A	G	19: 17,178,871	D47G	probably damaging	Het
Sh2b2	A	G	5: 136,224,233	S362P	probably damaging	Het
Snap91	G	A	9: 86,806,520	T322I	probably damaging	Het
Tcea1	T	C	1: 4,894,935	V276A	probably benign	Het
Tex15	T	C	8: 33,574,166	V1208A	probably benign	Het
Tomm40	G	T	7: 19,713,673	T144K	possibly damaging	Het
Zbed5	G	A	5: 129,903,159	D650N	possibly damaging	Het
Zfp326	A	G	5: 105,888,843		probably null	Het
Zfp647	G	A	15: 76,910,910	R517W	probably damaging	Het

Other mutations in Taf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Taf3	APN	2	9952917	missense	probably damaging	1.00
IGL01620:Taf3	APN	2	9952661	missense	probably benign	0.00
IGL02084:Taf3	APN	2	10042519	missense	probably benign	0.08
IGL02229:Taf3	APN	2	9952834	missense	probably damaging	1.00
IGL02891:Taf3	APN	2	9921227	missense	probably damaging	1.00
IGL03173:Taf3	APN	2	9952927	missense	probably damaging	0.99
IGL03302:Taf3	APN	2	9952131	missense	probably damaging	1.00
Howard	UTSW	2	9951160	missense	probably damaging	0.99
R0344:Taf3	UTSW	2	9951898	missense	probably benign	0.05
R0348:Taf3	UTSW	2	10042644	missense	probably benign	0.05
R0506:Taf3	UTSW	2	9940993	missense	probably benign	0.00
R1724:Taf3	UTSW	2	9952366	missense	probably benign	0.01
R2151:Taf3	UTSW	2	9951566	missense	possibly damaging	0.82
R2154:Taf3	UTSW	2	9951566	missense	possibly damaging	0.82
R2495:Taf3	UTSW	2	9952833	missense	probably damaging	1.00
R3739:Taf3	UTSW	2	9951658	missense	possibly damaging	0.89
R3921:Taf3	UTSW	2	10048298	missense	probably benign	0.06
R4097:Taf3	UTSW	2	9952367	missense	possibly damaging	0.54
R4602:Taf3	UTSW	2	9952657	missense	probably damaging	0.96
R4615:Taf3	UTSW	2	9952090	missense	probably damaging	1.00
R4679:Taf3	UTSW	2	10048564	utr 5 prime	probably benign
R4789:Taf3	UTSW	2	9951959	missense	probably damaging	1.00
R4801:Taf3	UTSW	2	9951123	missense	possibly damaging	0.72
R4802:Taf3	UTSW	2	9951123	missense	possibly damaging	0.72
R5201:Taf3	UTSW	2	9952184	missense	probably damaging	1.00
R5522:Taf3	UTSW	2	9941005	missense	probably damaging	1.00
R5629:Taf3	UTSW	2	9918178	missense	probably damaging	1.00
R6427:Taf3	UTSW	2	9951353	missense	probably damaging	0.98
R6492:Taf3	UTSW	2	9951160	missense	probably damaging	0.99
R6804:Taf3	UTSW	2	9918217	missense	possibly damaging	0.91
R7282:Taf3	UTSW	2	9951442	missense	probably damaging	0.96
R7293:Taf3	UTSW	2	9952090	missense	probably damaging	0.98
R7368:Taf3	UTSW	2	9916377	missense	unknown
R7637:Taf3	UTSW	2	9940993	missense	probably benign	0.00
R7686:Taf3	UTSW	2	9951488	missense	probably damaging	1.00
R8251:Taf3	UTSW	2	9918151	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACATGAGCTACAATCTTGGGG -3'
(R):5'- TCCTGAGCACTAAAGGGGAC -3'

Sequencing Primer
(F):5'- CTACAATCTTGGGGCTCTTAGGAC -3'
(R):5'- CCTAGATGTTGTGTTGTTAGAAGCAC -3'

Posted On

2015-01-23