Incidental Mutation 'R3702:Taf3'
ID258552
Institutional Source Beutler Lab
Gene Symbol Taf3
Ensembl Gene ENSMUSG00000025782
Gene NameTATA-box binding protein associated factor 3
SynonymsmTAFII140, 4933439M23Rik
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location9914552-10048596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9952561 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 112 (T112I)
Ref Sequence ENSEMBL: ENSMUSP00000110559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]
Predicted Effect probably benign
Transcript: ENSMUST00000026888
AA Change: T265I

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: T265I

DomainStartEndE-ValueType
BTP 3 79 1.94e-34 SMART
low complexity region 159 173 N/A INTRINSIC
low complexity region 237 253 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
coiled coil region 519 572 N/A INTRINSIC
coiled coil region 611 651 N/A INTRINSIC
coiled coil region 692 751 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
low complexity region 795 821 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
PHD 869 915 4.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114909
AA Change: T112I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: T112I

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 334 352 N/A INTRINSIC
coiled coil region 366 419 N/A INTRINSIC
coiled coil region 458 498 N/A INTRINSIC
coiled coil region 539 598 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 642 668 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
PHD 716 762 4.77e-11 SMART
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Taf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Taf3 APN 2 9952917 missense probably damaging 1.00
IGL01620:Taf3 APN 2 9952661 missense probably benign 0.00
IGL02084:Taf3 APN 2 10042519 missense probably benign 0.08
IGL02229:Taf3 APN 2 9952834 missense probably damaging 1.00
IGL02891:Taf3 APN 2 9921227 missense probably damaging 1.00
IGL03173:Taf3 APN 2 9952927 missense probably damaging 0.99
IGL03302:Taf3 APN 2 9952131 missense probably damaging 1.00
Howard UTSW 2 9951160 missense probably damaging 0.99
R0344:Taf3 UTSW 2 9951898 missense probably benign 0.05
R0348:Taf3 UTSW 2 10042644 missense probably benign 0.05
R0506:Taf3 UTSW 2 9940993 missense probably benign 0.00
R1724:Taf3 UTSW 2 9952366 missense probably benign 0.01
R2151:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2154:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2495:Taf3 UTSW 2 9952833 missense probably damaging 1.00
R3739:Taf3 UTSW 2 9951658 missense possibly damaging 0.89
R3921:Taf3 UTSW 2 10048298 missense probably benign 0.06
R4097:Taf3 UTSW 2 9952367 missense possibly damaging 0.54
R4602:Taf3 UTSW 2 9952657 missense probably damaging 0.96
R4615:Taf3 UTSW 2 9952090 missense probably damaging 1.00
R4679:Taf3 UTSW 2 10048564 utr 5 prime probably benign
R4789:Taf3 UTSW 2 9951959 missense probably damaging 1.00
R4801:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R4802:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R5201:Taf3 UTSW 2 9952184 missense probably damaging 1.00
R5522:Taf3 UTSW 2 9941005 missense probably damaging 1.00
R5629:Taf3 UTSW 2 9918178 missense probably damaging 1.00
R6427:Taf3 UTSW 2 9951353 missense probably damaging 0.98
R6492:Taf3 UTSW 2 9951160 missense probably damaging 0.99
R6804:Taf3 UTSW 2 9918217 missense possibly damaging 0.91
R7282:Taf3 UTSW 2 9951442 missense probably damaging 0.96
R7293:Taf3 UTSW 2 9952090 missense probably damaging 0.98
R7368:Taf3 UTSW 2 9916377 missense unknown
R7637:Taf3 UTSW 2 9940993 missense probably benign 0.00
R7686:Taf3 UTSW 2 9951488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGAGCTACAATCTTGGGG -3'
(R):5'- TCCTGAGCACTAAAGGGGAC -3'

Sequencing Primer
(F):5'- CTACAATCTTGGGGCTCTTAGGAC -3'
(R):5'- CCTAGATGTTGTGTTGTTAGAAGCAC -3'
Posted On2015-01-23