Incidental Mutation 'R3702:Ppig'
ID258553
Institutional Source Beutler Lab
Gene Symbol Ppig
Ensembl Gene ENSMUSG00000042133
Gene Namepeptidyl-prolyl isomerase G (cyclophilin G)
SynonymsSRCyp, B230312B02Rik
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69722545-69754012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69733209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 89 (S89T)
Ref Sequence ENSEMBL: ENSMUSP00000088370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040915] [ENSMUST00000090858] [ENSMUST00000144652]
Predicted Effect probably damaging
Transcript: ENSMUST00000040915
AA Change: S89T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045945
Gene: ENSMUSG00000042133
AA Change: S89T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.8e-50 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000090858
AA Change: S89T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088370
Gene: ENSMUSG00000042133
AA Change: S89T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.7e-49 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142839
Predicted Effect probably damaging
Transcript: ENSMUST00000144652
AA Change: S89T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114570
Gene: ENSMUSG00000042133
AA Change: S89T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 127 8.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146234
Meta Mutation Damage Score 0.8128 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Ppig
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Ppig APN 2 69749716 missense unknown
IGL00780:Ppig APN 2 69732924 missense possibly damaging 0.89
IGL02043:Ppig APN 2 69735983 splice site probably null
IGL02420:Ppig APN 2 69732227 missense probably benign 0.03
IGL02736:Ppig APN 2 69736094 missense probably damaging 1.00
R0358:Ppig UTSW 2 69743598 splice site probably benign
R0396:Ppig UTSW 2 69735976 unclassified probably benign
R1035:Ppig UTSW 2 69749459 missense unknown
R1159:Ppig UTSW 2 69750224 missense unknown
R1396:Ppig UTSW 2 69749018 missense unknown
R1593:Ppig UTSW 2 69749081 missense unknown
R1629:Ppig UTSW 2 69735873 missense probably damaging 1.00
R1799:Ppig UTSW 2 69749400 missense unknown
R2001:Ppig UTSW 2 69741644 missense unknown
R2112:Ppig UTSW 2 69750107 missense unknown
R3855:Ppig UTSW 2 69749375 missense unknown
R4999:Ppig UTSW 2 69741486 missense unknown
R5001:Ppig UTSW 2 69741486 missense unknown
R5153:Ppig UTSW 2 69749650 missense unknown
R5218:Ppig UTSW 2 69732783 intron probably benign
R5336:Ppig UTSW 2 69750224 missense unknown
R5410:Ppig UTSW 2 69735897 missense probably null 1.00
R5443:Ppig UTSW 2 69734291 missense probably damaging 1.00
R5513:Ppig UTSW 2 69750359 missense probably benign 0.23
R6179:Ppig UTSW 2 69750127 missense unknown
R6333:Ppig UTSW 2 69749558 missense unknown
R6604:Ppig UTSW 2 69741581 missense unknown
R6932:Ppig UTSW 2 69732411 missense probably benign 0.40
R7206:Ppig UTSW 2 69741566 missense unknown
R7220:Ppig UTSW 2 69749976 missense unknown
R7308:Ppig UTSW 2 69749462 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGGTGGTGACTTCAGTGAAG -3'
(R):5'- CTGAACCTCCATCAGAGCATTG -3'

Sequencing Primer
(F):5'- GGACAATTTACAAGAGTCAGTCCTC -3'
(R):5'- GAACCTCCATCAGAGCATTGTTTAC -3'
Posted On2015-01-23