Incidental Mutation 'R3702:Lyn'
ID258555
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene NameLYN proto-oncogene, Src family tyrosine kinase
SynonymsHck-2
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3678115-3813122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3742455 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 28 (H28R)
Ref Sequence ENSEMBL: ENSMUSP00000100075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]
Predicted Effect probably benign
Transcript: ENSMUST00000041377
AA Change: H49R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: H49R

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103010
AA Change: H28R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: H28R

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145083
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0582:Lyn UTSW 4 3743296 missense probably damaging 1.00
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 1.00
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATGAGAGCCTAGCTAGG -3'
(R):5'- TCAAAACCATGCTTAGGAAAGGAC -3'

Sequencing Primer
(F):5'- ATGAGAGCCTAGCTAGGAGCCC -3'
(R):5'- CCTCCTGATATGAACACTGGTGATG -3'
Posted On2015-01-23